Incidental Mutation 'R0848:Pih1d1'
ID77422
Institutional Source Beutler Lab
Gene Symbol Pih1d1
Ensembl Gene ENSMUSG00000003423
Gene NamePIH1 domain containing 1
Synonyms1110061L23Rik, 4933413A04Rik, Nop17
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45154303-45160065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45157617 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 58 (T58A)
Ref Sequence ENSEMBL: ENSMUSP00000147265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085375] [ENSMUST00000107811] [ENSMUST00000107815] [ENSMUST00000209847] [ENSMUST00000209954] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000210139] [ENSMUST00000211709] [ENSMUST00000211362] [ENSMUST00000211414]
Predicted Effect probably damaging
Transcript: ENSMUST00000085375
AA Change: T58A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082490
Gene: ENSMUSG00000003423
AA Change: T58A

DomainStartEndE-ValueType
Pfam:PIH1 23 207 1.8e-50 PFAM
Pfam:PIH1 211 285 2.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107811
AA Change: T58A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103441
Gene: ENSMUSG00000003423
AA Change: T58A

DomainStartEndE-ValueType
Pfam:PIH1 23 207 1.8e-50 PFAM
Pfam:PIH1 211 285 2.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107813
AA Change: T58A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103443
Gene: ENSMUSG00000003423
AA Change: T58A

DomainStartEndE-ValueType
Pfam:PIH1 22 209 7.6e-39 PFAM
Pfam:PIH1 205 285 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107815
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209581
Predicted Effect probably damaging
Transcript: ENSMUST00000209847
AA Change: T58A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209889
Predicted Effect probably damaging
Transcript: ENSMUST00000209954
AA Change: T58A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably benign
Transcript: ENSMUST00000209963
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect probably damaging
Transcript: ENSMUST00000210139
AA Change: T58A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211709
AA Change: T125A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211336
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Predicted Effect probably benign
Transcript: ENSMUST00000211414
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Pih1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pih1d1 APN 7 45159964 missense probably damaging 1.00
IGL01327:Pih1d1 APN 7 45159975 missense probably benign 0.00
IGL02011:Pih1d1 APN 7 45156732 missense probably damaging 1.00
IGL03145:Pih1d1 APN 7 45159121 critical splice donor site probably null
R0659:Pih1d1 UTSW 7 45159975 missense probably benign 0.06
R0686:Pih1d1 UTSW 7 45156329 nonsense probably null
R0845:Pih1d1 UTSW 7 45159682 missense probably benign 0.37
R1679:Pih1d1 UTSW 7 45159826 critical splice donor site probably null
R1894:Pih1d1 UTSW 7 45157741 missense probably damaging 1.00
R4467:Pih1d1 UTSW 7 45158497 missense possibly damaging 0.78
R4899:Pih1d1 UTSW 7 45154527 intron probably benign
R5033:Pih1d1 UTSW 7 45154854 unclassified probably benign
R5435:Pih1d1 UTSW 7 45156272 splice site probably null
R6037:Pih1d1 UTSW 7 45156314 missense probably damaging 0.98
R6037:Pih1d1 UTSW 7 45156314 missense probably damaging 0.98
R6145:Pih1d1 UTSW 7 45159044 missense probably damaging 0.99
R6564:Pih1d1 UTSW 7 45159819 missense probably damaging 1.00
R7557:Pih1d1 UTSW 7 45156759 missense probably benign 0.00
R8675:Pih1d1 UTSW 7 45154382 missense unknown
R8821:Pih1d1 UTSW 7 45156772 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTAGAGGTGCTTGTCACTAAGCCTG -3'
(R):5'- GCTGACTGGAAGCTCCTGAGAAAAG -3'

Sequencing Primer
(F):5'- GTGCTTGCACATATGCACAC -3'
(R):5'- GAGCAGACTCTGTGTCTTCCG -3'
Posted On2013-10-16