Incidental Mutation 'R0848:Trps1'
ID 77454
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Name transcriptional repressor GATA binding 1
Synonyms D15Ertd586e, trichorhinophalangeal syndrome I (human)
MMRRC Submission 039027-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0848 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 50518148-50753859 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 50524945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 704 (S704I)
Ref Sequence ENSEMBL: ENSMUSP00000139063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000077935
AA Change: S991I

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: S991I

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165201
AA Change: S991I

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: S991I

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183757
AA Change: S995I

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: S995I

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183997
AA Change: S806I

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: S806I

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184458
AA Change: S704I

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: S704I

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184885
AA Change: S745I

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: S745I

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,984 (GRCm39) H181Q probably damaging Het
Abca13 T A 11: 9,632,011 (GRCm39) L4977* probably null Het
Abca8a T A 11: 109,919,016 (GRCm39) Y1550F probably damaging Het
Actr2 C T 11: 20,022,584 (GRCm39) E296K probably benign Het
Agtpbp1 A T 13: 59,681,753 (GRCm39) probably benign Het
Anks1b A C 10: 89,906,987 (GRCm39) E268A probably damaging Het
C1rl A G 6: 124,485,465 (GRCm39) T279A probably benign Het
C5ar2 T C 7: 15,971,526 (GRCm39) T134A probably benign Het
Cdkl3 G A 11: 51,902,094 (GRCm39) R101Q probably damaging Het
Celsr2 A T 3: 108,321,654 (GRCm39) F386Y probably benign Het
Chd1 C T 17: 15,990,503 (GRCm39) P1685L probably damaging Het
Chrne G T 11: 70,506,239 (GRCm39) H402Q probably benign Het
Clvs1 A G 4: 9,282,003 (GRCm39) D149G possibly damaging Het
Cntnap5b T C 1: 100,182,888 (GRCm39) Y620H probably benign Het
Col6a1 A G 10: 76,549,458 (GRCm39) probably null Het
Cyp2d26 T A 15: 82,674,434 (GRCm39) I483F probably benign Het
Dlx6 C T 6: 6,863,665 (GRCm39) Q96* probably null Het
Dmac2l A T 12: 69,788,584 (GRCm39) H161L probably benign Het
Eif1a T A 18: 46,741,114 (GRCm39) N116K possibly damaging Het
Epb41l5 A T 1: 119,477,684 (GRCm39) C696S probably benign Het
Exoc7 A G 11: 116,186,074 (GRCm39) S376P possibly damaging Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Gimap7 T C 6: 48,700,657 (GRCm39) I81T probably damaging Het
Gtf2a1l T C 17: 89,001,657 (GRCm39) V171A probably damaging Het
Hax1 A G 3: 89,902,940 (GRCm39) S253P probably damaging Het
Hsd3b5 A T 3: 98,526,671 (GRCm39) D258E probably damaging Het
Kcnb1 G T 2: 166,948,187 (GRCm39) F220L probably damaging Het
Kif1a T A 1: 92,947,620 (GRCm39) Y1708F probably damaging Het
Krt14 A T 11: 100,095,090 (GRCm39) I379N probably damaging Het
Lpxn A G 19: 12,781,401 (GRCm39) I40V probably benign Het
Lrp1 C T 10: 127,389,231 (GRCm39) probably null Het
Lyst G A 13: 13,809,515 (GRCm39) R395H probably benign Het
Mindy4 G A 6: 55,295,271 (GRCm39) W737* probably null Het
Mki67 C A 7: 135,302,772 (GRCm39) R754L probably benign Het
Morf4l1 A G 9: 89,982,502 (GRCm39) V144A probably benign Het
Mvb12a T C 8: 71,998,422 (GRCm39) S186P probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Nipal1 A G 5: 72,825,183 (GRCm39) N292S probably damaging Het
Nqo2 T G 13: 34,156,461 (GRCm39) probably null Het
Or14a256 T C 7: 86,264,848 (GRCm39) Y335C probably damaging Het
Or2d3b A G 7: 106,514,200 (GRCm39) K265R probably benign Het
Or5ak24 A T 2: 85,260,365 (GRCm39) N269K probably benign Het
Or6c214 C T 10: 129,591,077 (GRCm39) V81I probably benign Het
Osbpl7 C A 11: 96,951,350 (GRCm39) P507Q probably damaging Het
Pcdhb1 G A 18: 37,400,475 (GRCm39) G809S probably benign Het
Pcm1 T C 8: 41,735,720 (GRCm39) V846A probably damaging Het
Phf3 A G 1: 30,902,253 (GRCm39) L20P probably damaging Het
Pih1d1 A G 7: 44,807,041 (GRCm39) T58A probably damaging Het
Plekhn1 A G 4: 156,308,021 (GRCm39) probably null Het
Plvap A T 8: 71,959,526 (GRCm39) L422Q probably damaging Het
Polq C T 16: 36,882,492 (GRCm39) A1273V probably benign Het
Prelid2 T A 18: 42,068,289 (GRCm39) I51F probably damaging Het
Ptpn18 G A 1: 34,501,783 (GRCm39) D8N probably damaging Het
Ptpra T A 2: 130,360,911 (GRCm39) F190Y probably damaging Het
Pus7l A G 15: 94,438,393 (GRCm39) S151P probably benign Het
Rsph6a G A 7: 18,791,595 (GRCm39) D255N probably benign Het
Serpinb6c A T 13: 34,083,288 (GRCm39) V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 (GRCm39) N22S probably benign Het
Snx5 G A 2: 144,095,726 (GRCm39) R312C probably damaging Het
Stard9 T C 2: 120,526,304 (GRCm39) S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,144,733 (GRCm39) probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,144,734 (GRCm39) probably null Het
Tlr12 A G 4: 128,510,084 (GRCm39) I722T probably benign Het
Tmem101 A T 11: 102,046,692 (GRCm39) M59K possibly damaging Het
Trim34a C T 7: 103,910,331 (GRCm39) R378C probably benign Het
Trim35 T A 14: 66,546,574 (GRCm39) M447K probably benign Het
Vmn1r231 T A 17: 21,110,433 (GRCm39) S161C probably damaging Het
Vps13a A C 19: 16,676,261 (GRCm39) N1237K probably damaging Het
Zfp619 G T 7: 39,185,983 (GRCm39) C671F probably damaging Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50,710,266 (GRCm39) missense probably benign 0.07
IGL00497:Trps1 APN 15 50,524,703 (GRCm39) missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50,524,481 (GRCm39) missense probably damaging 1.00
IGL01325:Trps1 APN 15 50,710,210 (GRCm39) missense probably benign 0.40
IGL02132:Trps1 APN 15 50,685,674 (GRCm39) missense probably damaging 1.00
IGL02631:Trps1 APN 15 50,709,417 (GRCm39) missense probably damaging 1.00
IGL02740:Trps1 APN 15 50,709,935 (GRCm39) missense probably damaging 1.00
IGL02821:Trps1 APN 15 50,524,273 (GRCm39) missense probably damaging 1.00
IGL03096:Trps1 APN 15 50,709,875 (GRCm39) missense probably benign
F5770:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
R0050:Trps1 UTSW 15 50,628,921 (GRCm39) missense probably benign 0.18
R0244:Trps1 UTSW 15 50,528,139 (GRCm39) missense probably damaging 1.00
R0377:Trps1 UTSW 15 50,695,174 (GRCm39) nonsense probably null
R0599:Trps1 UTSW 15 50,695,256 (GRCm39) nonsense probably null
R1744:Trps1 UTSW 15 50,524,609 (GRCm39) missense probably damaging 1.00
R1830:Trps1 UTSW 15 50,524,532 (GRCm39) missense probably damaging 0.99
R2083:Trps1 UTSW 15 50,685,701 (GRCm39) missense probably damaging 1.00
R2167:Trps1 UTSW 15 50,695,126 (GRCm39) missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50,685,794 (GRCm39) missense probably damaging 1.00
R2314:Trps1 UTSW 15 50,524,742 (GRCm39) missense probably damaging 1.00
R3735:Trps1 UTSW 15 50,709,456 (GRCm39) missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50,694,783 (GRCm39) missense probably damaging 1.00
R4223:Trps1 UTSW 15 50,710,044 (GRCm39) missense probably benign
R4280:Trps1 UTSW 15 50,709,478 (GRCm39) missense probably benign 0.00
R4566:Trps1 UTSW 15 50,695,074 (GRCm39) missense probably damaging 1.00
R4810:Trps1 UTSW 15 50,685,692 (GRCm39) missense probably benign 0.14
R4828:Trps1 UTSW 15 50,524,073 (GRCm39) makesense probably null
R4838:Trps1 UTSW 15 50,690,712 (GRCm39) missense probably benign 0.05
R4852:Trps1 UTSW 15 50,709,705 (GRCm39) missense probably damaging 1.00
R5001:Trps1 UTSW 15 50,524,703 (GRCm39) missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50,528,156 (GRCm39) missense probably damaging 1.00
R5463:Trps1 UTSW 15 50,695,286 (GRCm39) nonsense probably null
R5677:Trps1 UTSW 15 50,709,504 (GRCm39) missense probably damaging 1.00
R5691:Trps1 UTSW 15 50,690,700 (GRCm39) missense probably benign
R6432:Trps1 UTSW 15 50,694,793 (GRCm39) missense probably damaging 0.96
R6528:Trps1 UTSW 15 50,685,823 (GRCm39) missense probably benign 0.01
R6594:Trps1 UTSW 15 50,694,351 (GRCm39) missense probably damaging 0.99
R6827:Trps1 UTSW 15 50,685,959 (GRCm39) missense probably benign 0.14
R6862:Trps1 UTSW 15 50,695,001 (GRCm39) critical splice donor site probably null
R6912:Trps1 UTSW 15 50,685,694 (GRCm39) missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50,685,793 (GRCm39) missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50,695,273 (GRCm39) missense probably damaging 0.99
R7857:Trps1 UTSW 15 50,524,401 (GRCm39) missense probably damaging 1.00
R7986:Trps1 UTSW 15 50,753,019 (GRCm39) missense probably benign 0.00
R7986:Trps1 UTSW 15 50,525,132 (GRCm39) missense probably damaging 1.00
R8744:Trps1 UTSW 15 50,524,642 (GRCm39) missense probably damaging 1.00
R8838:Trps1 UTSW 15 50,753,007 (GRCm39) missense probably benign 0.01
R8859:Trps1 UTSW 15 50,685,769 (GRCm39) missense possibly damaging 0.77
R8935:Trps1 UTSW 15 50,752,344 (GRCm39) nonsense probably null
R9044:Trps1 UTSW 15 50,686,003 (GRCm39) missense probably benign 0.11
R9142:Trps1 UTSW 15 50,524,658 (GRCm39) missense probably damaging 0.98
R9211:Trps1 UTSW 15 50,694,840 (GRCm39) missense probably damaging 1.00
R9283:Trps1 UTSW 15 50,694,447 (GRCm39) missense probably damaging 1.00
R9363:Trps1 UTSW 15 50,524,676 (GRCm39) missense probably damaging 1.00
R9402:Trps1 UTSW 15 50,709,652 (GRCm39) missense probably damaging 1.00
R9562:Trps1 UTSW 15 50,524,657 (GRCm39) missense probably damaging 1.00
R9647:Trps1 UTSW 15 50,524,944 (GRCm39) missense probably benign 0.09
R9803:Trps1 UTSW 15 50,710,090 (GRCm39) missense possibly damaging 0.94
V7580:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
V7581:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
V7583:Trps1 UTSW 15 50,694,973 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCAAGTAGTGCGGATTCCCAG -3'
(R):5'- TGTGTGTTCCCAACAGACTCCCAG -3'

Sequencing Primer
(F):5'- AATCAGCTTCACTCTGGAAGTC -3'
(R):5'- CTTAACCCAGAGGCACTTCA -3'
Posted On 2013-10-16