Mutagenetix > Incidental Mutations

Incidental Mutation 'R0848:Chd1'

77458

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

039027-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0848 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 15770241 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1685 (P1685L)

Ref Sequence

ENSEMBL: ENSMUSP00000024627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024627]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024627
AA Change: P1685L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: P1685L

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1234	1e-112	BLAST
PDB:4B4C\|A	1119	1320	1e-132	PDB
low complexity region	1325	1348	N/A	INTRINSIC
low complexity region	1377	1388	N/A	INTRINSIC
DUF4208	1396	1500	5.54e-51	SMART
low complexity region	1507	1516	N/A	INTRINSIC
low complexity region	1538	1549	N/A	INTRINSIC
low complexity region	1626	1650	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	T	6: 23,114,985	H181Q	probably damaging	Het
Abca13	T	A	11: 9,682,011	L4977*	probably null	Het
Abca8a	T	A	11: 110,028,190	Y1550F	probably damaging	Het
Actr2	C	T	11: 20,072,584	E296K	probably benign	Het
Agtpbp1	A	T	13: 59,533,939		probably benign	Het
Anks1b	A	C	10: 90,071,125	E268A	probably damaging	Het
Atp5s	A	T	12: 69,741,810	H161L	probably benign	Het
C1rl	A	G	6: 124,508,506	T279A	probably benign	Het
C5ar2	T	C	7: 16,237,601	T134A	probably benign	Het
Cdkl3	G	A	11: 52,011,267	R101Q	probably damaging	Het
Celsr2	A	T	3: 108,414,338	F386Y	probably benign	Het
Chrne	G	T	11: 70,615,413	H402Q	probably benign	Het
Clvs1	A	G	4: 9,282,003	D149G	possibly damaging	Het
Cntnap5b	T	C	1: 100,255,163	Y620H	probably benign	Het
Col6a1	A	G	10: 76,713,624		probably null	Het
Cyp2d26	T	A	15: 82,790,233	I483F	probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Eif1a	T	A	18: 46,608,047	N116K	possibly damaging	Het
Epb41l5	A	T	1: 119,549,954	C696S	probably benign	Het
Exoc7	A	G	11: 116,295,248	S376P	possibly damaging	Het
Fads1	C	T	19: 10,183,065	P5L	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gimap7	T	C	6: 48,723,723	I81T	probably damaging	Het
Gtf2a1l	T	C	17: 88,694,229	V171A	probably damaging	Het
Hax1	A	G	3: 89,995,633	S253P	probably damaging	Het
Hsd3b5	A	T	3: 98,619,355	D258E	probably damaging	Het
Kcnb1	G	T	2: 167,106,267	F220L	probably damaging	Het
Kif1a	T	A	1: 93,019,898	Y1708F	probably damaging	Het
Krt14	A	T	11: 100,204,264	I379N	probably damaging	Het
Lpxn	A	G	19: 12,804,037	I40V	probably benign	Het
Lrp1	C	T	10: 127,553,362		probably null	Het
Lyst	G	A	13: 13,634,930	R395H	probably benign	Het
Mindy4	G	A	6: 55,318,286	W737*	probably null	Het
Mki67	C	A	7: 135,701,043	R754L	probably benign	Het
Morf4l1	A	G	9: 90,100,449	V144A	probably benign	Het
Mvb12a	T	C	8: 71,545,778	S186P	probably benign	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Nipal1	A	G	5: 72,667,840	N292S	probably damaging	Het
Nqo2	T	G	13: 33,972,478		probably null	Het
Olfr1532-ps1	A	G	7: 106,914,993	K265R	probably benign	Het
Olfr294	T	C	7: 86,615,640	Y335C	probably damaging	Het
Olfr807	C	T	10: 129,755,208	V81I	probably benign	Het
Olfr994	A	T	2: 85,430,021	N269K	probably benign	Het
Osbpl7	C	A	11: 97,060,524	P507Q	probably damaging	Het
Pcdhb1	G	A	18: 37,267,422	G809S	probably benign	Het
Pcm1	T	C	8: 41,282,683	V846A	probably damaging	Het
Phf3	A	G	1: 30,863,172	L20P	probably damaging	Het
Pih1d1	A	G	7: 45,157,617	T58A	probably damaging	Het
Plekhn1	A	G	4: 156,223,564		probably null	Het
Plvap	A	T	8: 71,506,882	L422Q	probably damaging	Het
Polq	C	T	16: 37,062,130	A1273V	probably benign	Het
Prelid2	T	A	18: 41,935,224	I51F	probably damaging	Het
Ptpn18	G	A	1: 34,462,702	D8N	probably damaging	Het
Ptpra	T	A	2: 130,518,991	F190Y	probably damaging	Het
Pus7l	A	G	15: 94,540,512	S151P	probably benign	Het
Rsph6a	G	A	7: 19,057,670	D255N	probably benign	Het
Serpinb6c	A	T	13: 33,899,305	V42D	probably damaging	Het
Slc7a13	A	G	4: 19,818,866	N22S	probably benign	Het
Snx5	G	A	2: 144,253,806	R312C	probably damaging	Het
Stard9	T	C	2: 120,695,823	S854P	probably damaging	Het
Syne2	AAGAG	AAGAGAGAG	12: 76,097,959		probably null	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tlr12	A	G	4: 128,616,291	I722T	probably benign	Het
Tmem101	A	T	11: 102,155,866	M59K	possibly damaging	Het
Trim34a	C	T	7: 104,261,124	R378C	probably benign	Het
Trim35	T	A	14: 66,309,125	M447K	probably benign	Het
Trps1	C	A	15: 50,661,549	S704I	possibly damaging	Het
Vmn1r231	T	A	17: 20,890,171	S161C	probably damaging	Het
Vps13a	A	C	19: 16,698,897	N1237K	probably damaging	Het
Zfp619	G	T	7: 39,536,559	C671F	probably damaging	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15732565	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15749865	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15754997	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17378569	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15770097	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17378596	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15770168	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15742173	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17390053	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15734273	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15730807	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15749500	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15770298	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15725281	missense	possibly damaging	0.70
Holly	UTSW	17	15726283	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17393567	missense	probably damaging	1.00
R0197:Chd1	UTSW	17	15725431	missense	probably benign
R0285:Chd1	UTSW	17	17374680	splice site	probably benign
R0326:Chd1	UTSW	17	15768566	missense	probably damaging	1.00
R0326:Chd1	UTSW	17	15768568	missense	probably benign
R0372:Chd1	UTSW	17	17387290	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15749894	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15734342	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15742288	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15758261	unclassified	probably benign
R0701:Chd1	UTSW	17	15725431	missense	probably benign
R0788:Chd1	UTSW	17	15707114	missense	possibly damaging	0.86
R0883:Chd1	UTSW	17	15725431	missense	probably benign
R1169:Chd1	UTSW	17	15735732	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15725312	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17387480	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15739507	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15743232	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17387271	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15770303	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15762486	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15731006	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15742294	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15731871	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15770027	nonsense	probably null
R4242:Chd1	UTSW	17	15770027	nonsense	probably null
R4354:Chd1	UTSW	17	17390001	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17377817	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15733124	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15768753	nonsense	probably null
R4840:Chd1	UTSW	17	15768754	missense	probably damaging	1.00
R4880:Chd1	UTSW	17	17374654	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15742231	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15762405	missense	probably benign
R5078:Chd1	UTSW	17	15726354	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15728198	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15735743	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15754951	missense	probably benign	0.01
R5304:Chd1	UTSW	17	15770268	missense	possibly damaging	0.55
R5307:Chd1	UTSW	17	15732570	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15738549	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17385613	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15754932	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17377773	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15758688	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15730203	intron	probably null
R6373:Chd1	UTSW	17	15738636	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15730602	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17380988	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15738633	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15725430	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17387167	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15761366	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15706937	splice site	probably null
R7317:Chd1	UTSW	17	15742274	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15770237	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15749398	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15767475	missense	probably benign
R7763:Chd1	UTSW	17	15733041	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15761404	missense	probably benign
Z1176:Chd1	UTSW	17	15766347	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15768733	missense	probably damaging	1.00
Z1177:Chd1	UTSW	17	15747801	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGATCTCACTCGGACCATCGAATG -3'
(R):5'- TGCAGTATCGCAGTACAGTGCAG -3'

Sequencing Primer
(F):5'- TCGGACCATCGAATGCACTC -3'
(R):5'- ATAATAGACCTTGCGTCCTGGAG -3'

Posted On

2013-10-16