Incidental Mutation 'R0848:Gtf2a1l'
ID77460
Institutional Source Beutler Lab
Gene Symbol Gtf2a1l
Ensembl Gene ENSMUSG00000024154
Gene Namegeneral transcription factor IIA, 1-like
SynonymsGtf2a1lf, 1700011N16Rik, Alf
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location88668660-88715152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88694229 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 171 (V171A)
Ref Sequence ENSEMBL: ENSMUSP00000024970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024970] [ENSMUST00000161481]
Predicted Effect probably damaging
Transcript: ENSMUST00000024970
AA Change: V171A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024970
Gene: ENSMUSG00000024154
AA Change: V171A

DomainStartEndE-ValueType
TFIIA 9 468 6.87e-202 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161481
AA Change: V124A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124286
Gene: ENSMUSG00000024154
AA Change: V124A

DomainStartEndE-ValueType
Pfam:TFIIA 9 76 3.2e-29 PFAM
Pfam:TFIIA 70 243 3e-13 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of transcription factor IIA (TFIIA) on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lpxn A G 19: 12,804,037 I40V probably benign Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Gtf2a1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gtf2a1l APN 17 88694295 missense probably damaging 1.00
IGL00928:Gtf2a1l APN 17 88694462 missense probably benign 0.09
IGL00974:Gtf2a1l APN 17 88714949 missense probably damaging 1.00
IGL01024:Gtf2a1l APN 17 88671291 missense probably damaging 1.00
IGL02429:Gtf2a1l APN 17 88668713 start codon destroyed probably null 0.61
IGL02658:Gtf2a1l APN 17 88668718 missense probably benign 0.01
IGL03377:Gtf2a1l APN 17 88711593 missense probably benign 0.03
R0899:Gtf2a1l UTSW 17 88668724 missense possibly damaging 0.56
R1435:Gtf2a1l UTSW 17 88694315 missense probably damaging 1.00
R1716:Gtf2a1l UTSW 17 88694580 missense probably benign 0.06
R1861:Gtf2a1l UTSW 17 88714954 missense probably damaging 1.00
R2301:Gtf2a1l UTSW 17 88711472 missense probably benign
R2906:Gtf2a1l UTSW 17 88694655 missense possibly damaging 0.92
R4281:Gtf2a1l UTSW 17 88711637 missense possibly damaging 0.95
R4289:Gtf2a1l UTSW 17 88694456 missense probably damaging 0.98
R4771:Gtf2a1l UTSW 17 88690020 missense probably benign 0.23
R4904:Gtf2a1l UTSW 17 88690043 critical splice donor site probably null
R4941:Gtf2a1l UTSW 17 88714922 missense probably damaging 1.00
R5106:Gtf2a1l UTSW 17 88694645 missense possibly damaging 0.95
R6003:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6035:Gtf2a1l UTSW 17 88711534 missense probably benign 0.00
R6128:Gtf2a1l UTSW 17 88694658 missense probably null 0.94
R6246:Gtf2a1l UTSW 17 88671547 missense probably benign 0.09
R6481:Gtf2a1l UTSW 17 88711625 missense probably benign 0.09
R7344:Gtf2a1l UTSW 17 88694103 missense probably damaging 1.00
R7462:Gtf2a1l UTSW 17 88694138 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GAGCATACCTGTGGACATCACACAC -3'
(R):5'- ATGCGAAGCCCTACCTTCTCTGAC -3'

Sequencing Primer
(F):5'- acaccacacacacacacac -3'
(R):5'- GTGGAGTCGCATCCATATATACTGTC -3'
Posted On2013-10-16