Mutagenetix > Incidental Mutations

Incidental Mutation 'R0848:Gtf2a1l'

77460

Institutional Source

Beutler Lab

Gene Symbol

Gtf2a1l

Ensembl Gene

ENSMUSG00000024154

Gene Name

general transcription factor IIA, 1-like

Synonyms

Gtf2a1lf, 1700011N16Rik, Alf

MMRRC Submission

039027-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.537) question?

Stock #

R0848 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88668660-88715152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88694229 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 171 (V171A)

Ref Sequence

ENSEMBL: ENSMUSP00000024970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024970] [ENSMUST00000161481]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024970
AA Change: V171A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024970
Gene: ENSMUSG00000024154
AA Change: V171A

Domain	Start	End	E-Value	Type
TFIIA	9	468	6.87e-202	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161481
AA Change: V124A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124286
Gene: ENSMUSG00000024154
AA Change: V124A

Domain	Start	End	E-Value	Type
Pfam:TFIIA	9	76	3.2e-29	PFAM
Pfam:TFIIA	70	243	3e-13	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of transcription factor IIA (TFIIA) on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	A	T	6: 23,114,985	H181Q	probably damaging	Het
Abca13	T	A	11: 9,682,011	L4977*	probably null	Het
Abca8a	T	A	11: 110,028,190	Y1550F	probably damaging	Het
Actr2	C	T	11: 20,072,584	E296K	probably benign	Het
Agtpbp1	A	T	13: 59,533,939		probably benign	Het
Anks1b	A	C	10: 90,071,125	E268A	probably damaging	Het
Atp5s	A	T	12: 69,741,810	H161L	probably benign	Het
C1rl	A	G	6: 124,508,506	T279A	probably benign	Het
C5ar2	T	C	7: 16,237,601	T134A	probably benign	Het
Cdkl3	G	A	11: 52,011,267	R101Q	probably damaging	Het
Celsr2	A	T	3: 108,414,338	F386Y	probably benign	Het
Chd1	C	T	17: 15,770,241	P1685L	probably damaging	Het
Chrne	G	T	11: 70,615,413	H402Q	probably benign	Het
Clvs1	A	G	4: 9,282,003	D149G	possibly damaging	Het
Cntnap5b	T	C	1: 100,255,163	Y620H	probably benign	Het
Col6a1	A	G	10: 76,713,624		probably null	Het
Cyp2d26	T	A	15: 82,790,233	I483F	probably benign	Het
Dlx6	C	T	6: 6,863,665	Q96*	probably null	Het
Eif1a	T	A	18: 46,608,047	N116K	possibly damaging	Het
Epb41l5	A	T	1: 119,549,954	C696S	probably benign	Het
Exoc7	A	G	11: 116,295,248	S376P	possibly damaging	Het
Fads1	C	T	19: 10,183,065	P5L	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gimap7	T	C	6: 48,723,723	I81T	probably damaging	Het
Hax1	A	G	3: 89,995,633	S253P	probably damaging	Het
Hsd3b5	A	T	3: 98,619,355	D258E	probably damaging	Het
Kcnb1	G	T	2: 167,106,267	F220L	probably damaging	Het
Kif1a	T	A	1: 93,019,898	Y1708F	probably damaging	Het
Krt14	A	T	11: 100,204,264	I379N	probably damaging	Het
Lpxn	A	G	19: 12,804,037	I40V	probably benign	Het
Lrp1	C	T	10: 127,553,362		probably null	Het
Lyst	G	A	13: 13,634,930	R395H	probably benign	Het
Mindy4	G	A	6: 55,318,286	W737*	probably null	Het
Mki67	C	A	7: 135,701,043	R754L	probably benign	Het
Morf4l1	A	G	9: 90,100,449	V144A	probably benign	Het
Mvb12a	T	C	8: 71,545,778	S186P	probably benign	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Nipal1	A	G	5: 72,667,840	N292S	probably damaging	Het
Nqo2	T	G	13: 33,972,478		probably null	Het
Olfr1532-ps1	A	G	7: 106,914,993	K265R	probably benign	Het
Olfr294	T	C	7: 86,615,640	Y335C	probably damaging	Het
Olfr807	C	T	10: 129,755,208	V81I	probably benign	Het
Olfr994	A	T	2: 85,430,021	N269K	probably benign	Het
Osbpl7	C	A	11: 97,060,524	P507Q	probably damaging	Het
Pcdhb1	G	A	18: 37,267,422	G809S	probably benign	Het
Pcm1	T	C	8: 41,282,683	V846A	probably damaging	Het
Phf3	A	G	1: 30,863,172	L20P	probably damaging	Het
Pih1d1	A	G	7: 45,157,617	T58A	probably damaging	Het
Plekhn1	A	G	4: 156,223,564		probably null	Het
Plvap	A	T	8: 71,506,882	L422Q	probably damaging	Het
Polq	C	T	16: 37,062,130	A1273V	probably benign	Het
Prelid2	T	A	18: 41,935,224	I51F	probably damaging	Het
Ptpn18	G	A	1: 34,462,702	D8N	probably damaging	Het
Ptpra	T	A	2: 130,518,991	F190Y	probably damaging	Het
Pus7l	A	G	15: 94,540,512	S151P	probably benign	Het
Rsph6a	G	A	7: 19,057,670	D255N	probably benign	Het
Serpinb6c	A	T	13: 33,899,305	V42D	probably damaging	Het
Slc7a13	A	G	4: 19,818,866	N22S	probably benign	Het
Snx5	G	A	2: 144,253,806	R312C	probably damaging	Het
Stard9	T	C	2: 120,695,823	S854P	probably damaging	Het
Syne2	AAGAG	AAGAGAGAG	12: 76,097,959		probably null	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tlr12	A	G	4: 128,616,291	I722T	probably benign	Het
Tmem101	A	T	11: 102,155,866	M59K	possibly damaging	Het
Trim34a	C	T	7: 104,261,124	R378C	probably benign	Het
Trim35	T	A	14: 66,309,125	M447K	probably benign	Het
Trps1	C	A	15: 50,661,549	S704I	possibly damaging	Het
Vmn1r231	T	A	17: 20,890,171	S161C	probably damaging	Het
Vps13a	A	C	19: 16,698,897	N1237K	probably damaging	Het
Zfp619	G	T	7: 39,536,559	C671F	probably damaging	Het

Other mutations in Gtf2a1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Gtf2a1l	APN	17	88694295	missense	probably damaging	1.00
IGL00928:Gtf2a1l	APN	17	88694462	missense	probably benign	0.09
IGL00974:Gtf2a1l	APN	17	88714949	missense	probably damaging	1.00
IGL01024:Gtf2a1l	APN	17	88671291	missense	probably damaging	1.00
IGL02429:Gtf2a1l	APN	17	88668713	start codon destroyed	probably null	0.61
IGL02658:Gtf2a1l	APN	17	88668718	missense	probably benign	0.01
IGL03377:Gtf2a1l	APN	17	88711593	missense	probably benign	0.03
R0899:Gtf2a1l	UTSW	17	88668724	missense	possibly damaging	0.56
R1435:Gtf2a1l	UTSW	17	88694315	missense	probably damaging	1.00
R1716:Gtf2a1l	UTSW	17	88694580	missense	probably benign	0.06
R1861:Gtf2a1l	UTSW	17	88714954	missense	probably damaging	1.00
R2301:Gtf2a1l	UTSW	17	88711472	missense	probably benign
R2906:Gtf2a1l	UTSW	17	88694655	missense	possibly damaging	0.92
R4281:Gtf2a1l	UTSW	17	88711637	missense	possibly damaging	0.95
R4289:Gtf2a1l	UTSW	17	88694456	missense	probably damaging	0.98
R4771:Gtf2a1l	UTSW	17	88690020	missense	probably benign	0.23
R4904:Gtf2a1l	UTSW	17	88690043	critical splice donor site	probably null
R4941:Gtf2a1l	UTSW	17	88714922	missense	probably damaging	1.00
R5106:Gtf2a1l	UTSW	17	88694645	missense	possibly damaging	0.95
R6003:Gtf2a1l	UTSW	17	88694103	missense	probably damaging	1.00
R6035:Gtf2a1l	UTSW	17	88711534	missense	probably benign	0.00
R6035:Gtf2a1l	UTSW	17	88711534	missense	probably benign	0.00
R6128:Gtf2a1l	UTSW	17	88694658	missense	probably null	0.94
R6246:Gtf2a1l	UTSW	17	88671547	missense	probably benign	0.09
R6481:Gtf2a1l	UTSW	17	88711625	missense	probably benign	0.09
R7344:Gtf2a1l	UTSW	17	88694103	missense	probably damaging	1.00
R7462:Gtf2a1l	UTSW	17	88694138	missense	possibly damaging	0.77
R8712:Gtf2a1l	UTSW	17	88714923	missense	probably damaging	1.00
R8849:Gtf2a1l	UTSW	17	88694138	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- GAGCATACCTGTGGACATCACACAC -3'
(R):5'- ATGCGAAGCCCTACCTTCTCTGAC -3'

Sequencing Primer
(F):5'- acaccacacacacacacac -3'
(R):5'- GTGGAGTCGCATCCATATATACTGTC -3'

Posted On

2013-10-16