Incidental Mutation 'R0848:Lpxn'
ID77466
Institutional Source Beutler Lab
Gene Symbol Lpxn
Ensembl Gene ENSMUSG00000024696
Gene Nameleupaxin
Synonyms4933402K05Rik, A530083L21Rik
MMRRC Submission 039027-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0848 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12798606-12833807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12804037 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 40 (I40V)
Ref Sequence ENSEMBL: ENSMUSP00000025601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025601]
Predicted Effect probably benign
Transcript: ENSMUST00000025601
AA Change: I40V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025601
Gene: ENSMUSG00000024696
AA Change: I40V

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
LIM 151 202 3.17e-17 SMART
LIM 210 261 1.98e-18 SMART
LIM 269 320 3.26e-19 SMART
LIM 328 379 3.34e-16 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is preferentially expressed in hematopoietic cells and belongs to the paxillin protein family. Similar to other members of this focal-adhesion-associated adaptor-protein family, it has four leucine-rich LD-motifs in the N-terminus and four LIM domains in the C-terminus. It may function in cell type-specific signaling by associating with PYK2, a member of focal adhesion kinase family. As a substrate for a tyrosine kinase in lymphoid cells, this protein may also function in, and be regulated by, tyrosine kinase activity. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,114,985 H181Q probably damaging Het
Abca13 T A 11: 9,682,011 L4977* probably null Het
Abca8a T A 11: 110,028,190 Y1550F probably damaging Het
Actr2 C T 11: 20,072,584 E296K probably benign Het
Agtpbp1 A T 13: 59,533,939 probably benign Het
Anks1b A C 10: 90,071,125 E268A probably damaging Het
Atp5s A T 12: 69,741,810 H161L probably benign Het
C1rl A G 6: 124,508,506 T279A probably benign Het
C5ar2 T C 7: 16,237,601 T134A probably benign Het
Cdkl3 G A 11: 52,011,267 R101Q probably damaging Het
Celsr2 A T 3: 108,414,338 F386Y probably benign Het
Chd1 C T 17: 15,770,241 P1685L probably damaging Het
Chrne G T 11: 70,615,413 H402Q probably benign Het
Clvs1 A G 4: 9,282,003 D149G possibly damaging Het
Cntnap5b T C 1: 100,255,163 Y620H probably benign Het
Col6a1 A G 10: 76,713,624 probably null Het
Cyp2d26 T A 15: 82,790,233 I483F probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Eif1a T A 18: 46,608,047 N116K possibly damaging Het
Epb41l5 A T 1: 119,549,954 C696S probably benign Het
Exoc7 A G 11: 116,295,248 S376P possibly damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gimap7 T C 6: 48,723,723 I81T probably damaging Het
Gtf2a1l T C 17: 88,694,229 V171A probably damaging Het
Hax1 A G 3: 89,995,633 S253P probably damaging Het
Hsd3b5 A T 3: 98,619,355 D258E probably damaging Het
Kcnb1 G T 2: 167,106,267 F220L probably damaging Het
Kif1a T A 1: 93,019,898 Y1708F probably damaging Het
Krt14 A T 11: 100,204,264 I379N probably damaging Het
Lrp1 C T 10: 127,553,362 probably null Het
Lyst G A 13: 13,634,930 R395H probably benign Het
Mindy4 G A 6: 55,318,286 W737* probably null Het
Mki67 C A 7: 135,701,043 R754L probably benign Het
Morf4l1 A G 9: 90,100,449 V144A probably benign Het
Mvb12a T C 8: 71,545,778 S186P probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Nipal1 A G 5: 72,667,840 N292S probably damaging Het
Nqo2 T G 13: 33,972,478 probably null Het
Olfr1532-ps1 A G 7: 106,914,993 K265R probably benign Het
Olfr294 T C 7: 86,615,640 Y335C probably damaging Het
Olfr807 C T 10: 129,755,208 V81I probably benign Het
Olfr994 A T 2: 85,430,021 N269K probably benign Het
Osbpl7 C A 11: 97,060,524 P507Q probably damaging Het
Pcdhb1 G A 18: 37,267,422 G809S probably benign Het
Pcm1 T C 8: 41,282,683 V846A probably damaging Het
Phf3 A G 1: 30,863,172 L20P probably damaging Het
Pih1d1 A G 7: 45,157,617 T58A probably damaging Het
Plekhn1 A G 4: 156,223,564 probably null Het
Plvap A T 8: 71,506,882 L422Q probably damaging Het
Polq C T 16: 37,062,130 A1273V probably benign Het
Prelid2 T A 18: 41,935,224 I51F probably damaging Het
Ptpn18 G A 1: 34,462,702 D8N probably damaging Het
Ptpra T A 2: 130,518,991 F190Y probably damaging Het
Pus7l A G 15: 94,540,512 S151P probably benign Het
Rsph6a G A 7: 19,057,670 D255N probably benign Het
Serpinb6c A T 13: 33,899,305 V42D probably damaging Het
Slc7a13 A G 4: 19,818,866 N22S probably benign Het
Snx5 G A 2: 144,253,806 R312C probably damaging Het
Stard9 T C 2: 120,695,823 S854P probably damaging Het
Syne2 AAGAG AAGAGAGAG 12: 76,097,959 probably null Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tlr12 A G 4: 128,616,291 I722T probably benign Het
Tmem101 A T 11: 102,155,866 M59K possibly damaging Het
Trim34a C T 7: 104,261,124 R378C probably benign Het
Trim35 T A 14: 66,309,125 M447K probably benign Het
Trps1 C A 15: 50,661,549 S704I possibly damaging Het
Vmn1r231 T A 17: 20,890,171 S161C probably damaging Het
Vps13a A C 19: 16,698,897 N1237K probably damaging Het
Zfp619 G T 7: 39,536,559 C671F probably damaging Het
Other mutations in Lpxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01895:Lpxn APN 19 12833086 missense probably damaging 0.99
IGL03088:Lpxn APN 19 12833211 missense probably damaging 1.00
IGL03203:Lpxn APN 19 12819406 missense probably benign 0.01
mascherano UTSW 19 12833172 missense probably damaging 0.99
R1514:Lpxn UTSW 19 12824050 missense probably damaging 1.00
R1532:Lpxn UTSW 19 12804092 critical splice donor site probably null
R1880:Lpxn UTSW 19 12804088 missense probably benign 0.17
R1937:Lpxn UTSW 19 12824910 missense probably benign 0.00
R2182:Lpxn UTSW 19 12832758 critical splice donor site probably null
R2897:Lpxn UTSW 19 12819358 missense probably benign 0.01
R4194:Lpxn UTSW 19 12833235 missense probably damaging 1.00
R4576:Lpxn UTSW 19 12833290 missense probably benign 0.17
R4844:Lpxn UTSW 19 12833172 missense probably damaging 0.99
R5567:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R5570:Lpxn UTSW 19 12832659 missense possibly damaging 0.90
R6060:Lpxn UTSW 19 12833125 missense probably damaging 1.00
R6366:Lpxn UTSW 19 12824799 missense probably benign 0.12
R6615:Lpxn UTSW 19 12824799 missense probably benign 0.12
R7116:Lpxn UTSW 19 12811258 missense probably benign 0.28
R7135:Lpxn UTSW 19 12833319 missense probably damaging 1.00
R7808:Lpxn UTSW 19 12824821 missense possibly damaging 0.55
R8290:Lpxn UTSW 19 12832688 missense probably damaging 1.00
Z1176:Lpxn UTSW 19 12824947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACACTCCTGAAGTGAGGTAAGGATG -3'
(R):5'- TCTCAGTTCTCCTCTTTCCAAAAGCAAC -3'

Sequencing Primer
(F):5'- GGTAAGGATGGAAGAAGGTATTTG -3'
(R):5'- GAAATGTTGTCACACTTGATTGTC -3'
Posted On2013-10-16