Incidental Mutation 'R0830:F2'
ID77475
Institutional Source Beutler Lab
Gene Symbol F2
Ensembl Gene ENSMUSG00000027249
Gene Namecoagulation factor II
SynonymsFII, Cf2, Cf-2, thrombin, prothrombin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0830 (G1)
Quality Score204
Status Not validated
Chromosome2
Chromosomal Location91625320-91636414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91630200 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 316 (E316G)
Ref Sequence ENSEMBL: ENSMUSP00000028681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028681] [ENSMUST00000111335]
PDB Structure
Structural basis of Na+ activation mimicry in murine thrombin [X-RAY DIFFRACTION]
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR3 [X-RAY DIFFRACTION]
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR4 [X-RAY DIFFRACTION]
Crystal structure of the W215A/E217A mutant of murine thrombin [X-RAY DIFFRACTION]
Crystal structure of murine thrombin mutant W215A/E217A (one molecule in the asymmetric unit) [X-RAY DIFFRACTION]
Crystal structure of murine thrombin mutant W215A/E217A (two molecules in the asymmetric unit) [X-RAY DIFFRACTION]
Crystal structure of murine thrombin mutant W215A/E217A in complex with the extracellular fragment of human PAR1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028681
AA Change: E316G

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028681
Gene: ENSMUSG00000027249
AA Change: E316G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 7.47e-37 SMART
KR 213 295 5.09e-30 SMART
Tryp_SPc 360 610 9.99e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111335
AA Change: E315G

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106967
Gene: ENSMUSG00000027249
AA Change: E315G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 8.01e-37 SMART
KR 212 294 5.09e-30 SMART
Tryp_SPc 359 609 9.99e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153182
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent glycoprotein coagulation factor that plays an important role in the process of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that undergoes enzymatic cleavage by the coagulation factor Xa to form an active serine protease that converts soluble fibrinogen to insoluble fibrin clot. Most of the mice lacking the encoded protein die at an embryonic stage due to defects in yolk sac vasculature, while the rare nenonates succumb to hemorrhage on the first postnatal day. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in yolk sac vasculature, internal bleeding, tissue necrosis, and die in mid- to late-gestation, or rarely, a few days after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in F2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02334:F2 APN 2 91633094 missense probably benign 0.16
IGL02390:F2 APN 2 91632987 missense possibly damaging 0.81
IGL02859:F2 APN 2 91625742 missense probably damaging 1.00
IGL02970:F2 APN 2 91625551 missense possibly damaging 0.95
IGL03278:F2 APN 2 91635182 missense probably benign 0.01
Sarode UTSW 2 91635194 missense probably benign 0.35
R0007:F2 UTSW 2 91630607 missense probably benign 0.00
R0015:F2 UTSW 2 91630607 missense probably benign 0.00
R0137:F2 UTSW 2 91625730 missense probably damaging 1.00
R0211:F2 UTSW 2 91630158 missense probably damaging 1.00
R0304:F2 UTSW 2 91633233 missense probably damaging 0.99
R0601:F2 UTSW 2 91633311 splice site probably null
R1693:F2 UTSW 2 91629179 missense probably damaging 1.00
R1720:F2 UTSW 2 91628830 nonsense probably null
R1763:F2 UTSW 2 91634906 missense probably damaging 1.00
R1865:F2 UTSW 2 91635194 missense probably benign 0.35
R1955:F2 UTSW 2 91633095 missense probably benign 0.01
R2055:F2 UTSW 2 91628442 missense probably benign 0.00
R2168:F2 UTSW 2 91628348 missense probably damaging 0.98
R2230:F2 UTSW 2 91625757 missense probably benign 0.01
R3916:F2 UTSW 2 91625488 missense probably damaging 1.00
R4004:F2 UTSW 2 91628396 missense possibly damaging 0.88
R4134:F2 UTSW 2 91629208 missense possibly damaging 0.93
R4298:F2 UTSW 2 91629320 critical splice acceptor site probably null
R4626:F2 UTSW 2 91630670 missense probably benign 0.07
R4902:F2 UTSW 2 91634971 intron probably benign
R5093:F2 UTSW 2 91634957 splice site probably benign
R5095:F2 UTSW 2 91634957 splice site probably benign
R5140:F2 UTSW 2 91634957 splice site probably benign
R5229:F2 UTSW 2 91630241 nonsense probably null
R5271:F2 UTSW 2 91635121 intron probably benign
R5335:F2 UTSW 2 91634932 missense possibly damaging 0.68
R7650:F2 UTSW 2 91628396 missense possibly damaging 0.88
R7762:F2 UTSW 2 91628696 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CAATTACTCGGCAGACATGGCAAAG -3'
(R):5'- TTAACCTCGGAGTCAAACGCCCTC -3'

Sequencing Primer
(F):5'- AGAGTCAAGAAGCTCCTTTTCGG -3'
(R):5'- GAGTCAAACGCCCTCCAATG -3'
Posted On2013-10-16