Incidental Mutation 'R0830:Nudt1'
ID77482
Institutional Source Beutler Lab
Gene Symbol Nudt1
Ensembl Gene ENSMUSG00000036639
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 1
SynonymsMth1, 8-oxo-7,8-dihydro-2'-dGTPase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location140321656-140338137 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 140335321 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031536] [ENSMUST00000031539] [ENSMUST00000050205] [ENSMUST00000071881] [ENSMUST00000110825] [ENSMUST00000110826] [ENSMUST00000110827] [ENSMUST00000196130] [ENSMUST00000197880] [ENSMUST00000198660]
Predicted Effect probably null
Transcript: ENSMUST00000031536
SMART Domains Protein: ENSMUSP00000031536
Gene: ENSMUSG00000029557

DomainStartEndE-ValueType
Pfam:FtsJ 52 237 8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031539
SMART Domains Protein: ENSMUSP00000031539
Gene: ENSMUSG00000029560

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
PX 60 173 1.56e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050205
AA Change: L54Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059983
Gene: ENSMUSG00000036639
AA Change: L54Q

DomainStartEndE-ValueType
Pfam:NUDIX 4 130 6.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071881
AA Change: L54Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071778
Gene: ENSMUSG00000036639
AA Change: L54Q

DomainStartEndE-ValueType
Pfam:NUDIX 4 130 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110825
AA Change: L54Q

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106449
Gene: ENSMUSG00000036639
AA Change: L54Q

DomainStartEndE-ValueType
Pfam:NUDIX 4 103 4.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110826
AA Change: L54Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106450
Gene: ENSMUSG00000036639
AA Change: L54Q

DomainStartEndE-ValueType
Pfam:NUDIX 4 130 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110827
AA Change: L54Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106451
Gene: ENSMUSG00000036639
AA Change: L54Q

DomainStartEndE-ValueType
Pfam:NUDIX 4 130 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145898
SMART Domains Protein: ENSMUSP00000120347
Gene: ENSMUSG00000036639

DomainStartEndE-ValueType
Pfam:NUDIX 1 64 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196130
SMART Domains Protein: ENSMUSP00000142390
Gene: ENSMUSG00000029560

DomainStartEndE-ValueType
PX 12 125 9.7e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197880
SMART Domains Protein: ENSMUSP00000142394
Gene: ENSMUSG00000029560

DomainStartEndE-ValueType
Pfam:PX 15 88 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198660
AA Change: L54Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143140
Gene: ENSMUSG00000036639
AA Change: L54Q

DomainStartEndE-ValueType
Pfam:NUDIX 4 112 2.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Misincorporation of oxidized nucleoside triphosphates into DNA/RNA during replication and transcription can cause mutations that may result in carcinogenesis or neurodegeneration. The protein encoded by this gene is an enzyme that hydrolyzes oxidized purine nucleoside triphosphates, such as 8-oxo-dGTP, 8-oxo-dATP, 2-hydroxy-dATP, and 2-hydroxy rATP, to monophosphates, thereby preventing misincorporation. The encoded protein is localized mainly in the cytoplasm, with some in the mitochondria, suggesting that it is involved in the sanitization of nucleotide pools both for nuclear and mitochondrial genomes. Several alternatively spliced transcript variants, some of which encode distinct isoforms, have been identified. Additional variants have been observed, but their full-length natures have not been determined. A single-nucleotide polymorphism that results in the production of an additional, longer isoform (p26) has been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aging mice homozygous for a knock-out allele show increased incidence of tumor formation in the lung, liver and stomach. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Nudt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Nudt1 APN 5 140337710 missense probably damaging 1.00
IGL02171:Nudt1 APN 5 140337593 missense probably damaging 1.00
R1676:Nudt1 UTSW 5 140334623 splice site probably null
R5073:Nudt1 UTSW 5 140331907 unclassified probably null
R5837:Nudt1 UTSW 5 140334540 missense probably damaging 1.00
R7211:Nudt1 UTSW 5 140337647 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TATAGCAATGCCTCTGCACGCTGTCC -3'
(R):5'- TGACTCATCCCCACGCTACAAGTCTG -3'

Sequencing Primer
(F):5'- TGTCCTCCTGGAATACGCAG -3'
(R):5'- TAGAAAGGCTTGGTGCCTATAC -3'
Posted On2013-10-16