Incidental Mutation 'R0830:Olfr448'
ID77484
Institutional Source Beutler Lab
Gene Symbol Olfr448
Ensembl Gene ENSMUSG00000043119
Gene Nameolfactory receptor 448
SynonymsGA_x6K02T2P3E9-4663051-4662119, MOR261-13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R0830 (G1)
Quality Score223
Status Not validated
Chromosome6
Chromosomal Location42890441-42899085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42896598 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 49 (W49L)
Ref Sequence ENSEMBL: ENSMUSP00000148884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058668] [ENSMUST00000213952] [ENSMUST00000214529]
Predicted Effect probably benign
Transcript: ENSMUST00000058668
AA Change: W49L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059195
Gene: ENSMUSG00000043119
AA Change: W49L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.8e-61 PFAM
Pfam:7tm_1 40 289 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213952
AA Change: W49L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000214529
AA Change: W49L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Olfr448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr448 APN 6 42896634 missense probably damaging 1.00
IGL02888:Olfr448 APN 6 42897329 missense probably damaging 1.00
R1173:Olfr448 UTSW 6 42897351 missense probably benign 0.11
R1846:Olfr448 UTSW 6 42897320 missense probably damaging 0.99
R1913:Olfr448 UTSW 6 42896753 missense probably damaging 0.97
R2178:Olfr448 UTSW 6 42896798 missense probably benign
R3115:Olfr448 UTSW 6 42896850 missense probably benign 0.01
R3116:Olfr448 UTSW 6 42896850 missense probably benign 0.01
R4717:Olfr448 UTSW 6 42897224 missense probably damaging 1.00
R5358:Olfr448 UTSW 6 42896520 missense probably benign 0.11
R6249:Olfr448 UTSW 6 42897304 missense probably damaging 0.98
R6860:Olfr448 UTSW 6 42896816 missense probably benign 0.35
R7122:Olfr448 UTSW 6 42897090 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCACGACGGTATGACAGAGAACC -3'
(R):5'- ATGGCAGCCTCAGGATAAGAACAAC -3'

Sequencing Primer
(F):5'- TATGACAGAGAACCAGACATGG -3'
(R):5'- CTTTCCAGCTCATGATGACAGAG -3'
Posted On2013-10-16