Incidental Mutation 'R0830:Ing4'
ID77485
Institutional Source Beutler Lab
Gene Symbol Ing4
Ensembl Gene ENSMUSG00000030330
Gene Nameinhibitor of growth family, member 4
Synonymsp29ING4, D6Wsu147e, D6Xrf92
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125039760-125049265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125043960 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 15 (E15G)
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000112417] [ENSMUST00000140131]
Predicted Effect probably damaging
Transcript: ENSMUST00000032480
AA Change: E15G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330
AA Change: E15G

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112417
AA Change: E15G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330
AA Change: E15G

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133695
Predicted Effect probably damaging
Transcript: ENSMUST00000140131
AA Change: E15G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330
AA Change: E15G

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140883
SMART Domains Protein: ENSMUSP00000118561
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151125
SMART Domains Protein: ENSMUSP00000119709
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 1.4e-34 PFAM
low complexity region 118 131 N/A INTRINSIC
PDB:1WEU|A 167 216 3e-32 PDB
SCOP:d1fp0a1 190 216 2e-3 SMART
Blast:PHD 197 215 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205110
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This protein can bind TP53 and EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in the TP53-dependent regulatory pathway. Multiple alternatively spliced transcript variants have been observed that encode distinct proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are hypersensitive to LPS challenge and exhibit elevated cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Ing4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Ing4 APN 6 125043986 missense possibly damaging 0.95
R0361:Ing4 UTSW 6 125047894 missense probably damaging 1.00
R2969:Ing4 UTSW 6 125047325 missense probably benign 0.01
R4849:Ing4 UTSW 6 125043983 missense probably damaging 0.98
R4955:Ing4 UTSW 6 125048201 missense probably damaging 0.97
R4971:Ing4 UTSW 6 125043998 missense probably benign 0.01
R5141:Ing4 UTSW 6 125039874 missense probably benign
R5561:Ing4 UTSW 6 125047060 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGTAACTAGGTGGCTCCAGATTCCC -3'
(R):5'- GTCACAGTTCACCAGATGGTACGG -3'

Sequencing Primer
(F):5'- ggctagggttgtagatcaggg -3'
(R):5'- CACCAGATGGTACGGTAGCAG -3'
Posted On2013-10-16