Incidental Mutation 'R0830:Vmn1r178'
ID77486
Institutional Source Beutler Lab
Gene Symbol Vmn1r178
Ensembl Gene ENSMUSG00000062598
Gene Namevomeronasal 1 receptor 178
SynonymsV1rd13, LOC232959
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location23892009-23895622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23894027 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 167 (T167A)
Ref Sequence ENSEMBL: ENSMUSP00000154244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078593] [ENSMUST00000226450] [ENSMUST00000226489] [ENSMUST00000226640] [ENSMUST00000227993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078593
AA Change: T167A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077666
Gene: ENSMUSG00000062598
AA Change: T167A

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 7.9e-11 PFAM
Pfam:7tm_1 15 283 2.5e-7 PFAM
Pfam:V1R 41 296 7.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226450
AA Change: T167A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226489
AA Change: T94A

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226640
AA Change: T94A

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227993
AA Change: T167A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Vmn1r178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Vmn1r178 APN 7 23893689 missense probably damaging 0.99
IGL01781:Vmn1r178 APN 7 23894009 missense probably damaging 1.00
IGL01934:Vmn1r178 APN 7 23893937 missense probably damaging 1.00
IGL02571:Vmn1r178 APN 7 23894235 missense probably damaging 0.99
IGL02727:Vmn1r178 APN 7 23894446 unclassified probably null
IGL03112:Vmn1r178 APN 7 23893661 missense probably damaging 1.00
R0112:Vmn1r178 UTSW 7 23894184 missense possibly damaging 0.93
R1186:Vmn1r178 UTSW 7 23893892 nonsense probably null
R1340:Vmn1r178 UTSW 7 23893856 missense probably benign 0.34
R1640:Vmn1r178 UTSW 7 23894123 missense possibly damaging 0.70
R1696:Vmn1r178 UTSW 7 23894200 missense probably damaging 0.99
R1746:Vmn1r178 UTSW 7 23893904 missense probably benign 0.00
R3084:Vmn1r178 UTSW 7 23893906 missense possibly damaging 0.94
R4368:Vmn1r178 UTSW 7 23894022 missense probably damaging 1.00
R5199:Vmn1r178 UTSW 7 23894389 missense probably benign 0.11
R6380:Vmn1r178 UTSW 7 23893559 missense possibly damaging 0.62
R7000:Vmn1r178 UTSW 7 23894337 missense probably benign 0.21
R7142:Vmn1r178 UTSW 7 23893610 missense probably damaging 1.00
R7268:Vmn1r178 UTSW 7 23893953 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGTTCTAAACAGAGGCCCAGACAG -3'
(R):5'- CCAGCATCAGGATAGTATGGGTTGC -3'

Sequencing Primer
(F):5'- GCCCAGACAGTTGATTTTAAGCC -3'
(R):5'- GGCCTCTGGCATCCTGATTG -3'
Posted On2013-10-16