Incidental Mutation 'R0830:Tex29'
ID77490
Institutional Source Beutler Lab
Gene Symbol Tex29
Ensembl Gene ENSMUSG00000031512
Gene Nametestis expressed 29
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0830 (G1)
Quality Score192
Status Not validated
Chromosome8
Chromosomal Location11840474-11855761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11854157 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000148049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033909] [ENSMUST00000166638] [ENSMUST00000209692] [ENSMUST00000209704]
Predicted Effect probably benign
Transcript: ENSMUST00000033909
AA Change: V81A

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033909
Gene: ENSMUSG00000031512
AA Change: V81A

DomainStartEndE-ValueType
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 105 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132536
Predicted Effect probably benign
Transcript: ENSMUST00000166638
AA Change: V81A

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132090
Gene: ENSMUSG00000031512
AA Change: V81A

DomainStartEndE-ValueType
Pfam:TEX29 13 88 9.6e-47 PFAM
low complexity region 105 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209692
AA Change: V99A

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000209704
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Tex29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Tex29 APN 8 11844231 nonsense probably null
R0562:Tex29 UTSW 8 11844138 splice site probably benign
R4829:Tex29 UTSW 8 11855668 utr 3 prime probably benign
R5723:Tex29 UTSW 8 11854279 utr 3 prime probably benign
R5892:Tex29 UTSW 8 11854288 utr 3 prime probably benign
R5902:Tex29 UTSW 8 11854276 utr 3 prime probably benign
R5902:Tex29 UTSW 8 11854277 utr 3 prime probably benign
R5902:Tex29 UTSW 8 11855723 utr 3 prime probably benign
R7866:Tex29 UTSW 8 11844055 missense unknown
R8118:Tex29 UTSW 8 11854263 missense unknown
Predicted Primers PCR Primer
(F):5'- ACACAGCCTGTCTTGTAGCACAATG -3'
(R):5'- TGGAATCCTTGCCCAGCCTAAAAC -3'

Sequencing Primer
(F):5'- GCACAATGTATACTTTCTAACTGGG -3'
(R):5'- ATTCCTGTCAAGGGCCATCAG -3'
Posted On2013-10-16