Incidental Mutation 'R0830:Adam26a'
Institutional Source Beutler Lab
Gene Symbol Adam26a
Ensembl Gene ENSMUSG00000048516
Gene Namea disintegrin and metallopeptidase domain 26A (testase 3)
SynonymsDtgn4, Adam26
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0830 (G1)
Quality Score137
Status Not validated
Chromosomal Location43568278-43576707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43568402 bp
Amino Acid Change Valine to Isoleucine at position 684 (V684I)
Ref Sequence ENSEMBL: ENSMUSP00000058256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049577]
Predicted Effect probably benign
Transcript: ENSMUST00000049577
AA Change: V684I

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058256
Gene: ENSMUSG00000048516
AA Change: V684I

signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 2.1e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 2.2e-9 PFAM
Pfam:Reprolysin 195 385 2.7e-48 PFAM
Pfam:Reprolysin_2 215 377 2.4e-16 PFAM
Pfam:Reprolysin_3 219 340 1.2e-15 PFAM
DISIN 401 476 2.98e-41 SMART
ACR 477 613 2.06e-64 SMART
transmembrane domain 671 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during the late stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to two other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Adam26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Adam26a APN 8 43568859 missense possibly damaging 0.75
IGL00519:Adam26a APN 8 43569525 missense probably damaging 1.00
IGL00658:Adam26a APN 8 43568903 missense probably benign 0.00
IGL01514:Adam26a APN 8 43568448 missense probably benign
IGL01988:Adam26a APN 8 43569170 missense possibly damaging 0.68
IGL02030:Adam26a APN 8 43568857 missense probably benign 0.00
IGL02081:Adam26a APN 8 43570196 missense probably damaging 0.99
IGL02444:Adam26a APN 8 43569673 missense possibly damaging 0.46
IGL02734:Adam26a APN 8 43569775 missense probably benign 0.27
IGL03243:Adam26a APN 8 43568696 missense probably benign 0.14
IGL03350:Adam26a APN 8 43569552 nonsense probably null
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0324:Adam26a UTSW 8 43568453 missense probably benign
R0960:Adam26a UTSW 8 43568763 missense probably damaging 1.00
R1259:Adam26a UTSW 8 43568647 missense probably benign 0.20
R1259:Adam26a UTSW 8 43568713 missense possibly damaging 0.95
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1719:Adam26a UTSW 8 43570036 missense possibly damaging 0.93
R1750:Adam26a UTSW 8 43570189 missense possibly damaging 0.90
R1860:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1861:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1875:Adam26a UTSW 8 43569851 missense probably benign 0.37
R3959:Adam26a UTSW 8 43569871 missense probably benign 0.00
R4355:Adam26a UTSW 8 43570185 missense probably benign 0.35
R4604:Adam26a UTSW 8 43570051 missense probably benign 0.02
R4612:Adam26a UTSW 8 43568793 missense probably damaging 0.99
R4909:Adam26a UTSW 8 43570438 missense probably benign 0.08
R4937:Adam26a UTSW 8 43568881 missense probably damaging 1.00
R5112:Adam26a UTSW 8 43568856 missense probably benign 0.04
R5276:Adam26a UTSW 8 43570420 missense probably benign 0.30
R5406:Adam26a UTSW 8 43569104 missense probably damaging 1.00
R5501:Adam26a UTSW 8 43569904 nonsense probably null
R5955:Adam26a UTSW 8 43569852 missense probably benign 0.11
R6262:Adam26a UTSW 8 43569088 missense possibly damaging 0.91
R6847:Adam26a UTSW 8 43568428 missense probably benign 0.23
R6957:Adam26a UTSW 8 43568903 missense probably benign 0.00
R7053:Adam26a UTSW 8 43568799 nonsense probably null
R7287:Adam26a UTSW 8 43570343 missense possibly damaging 0.95
R7393:Adam26a UTSW 8 43569688 missense probably benign 0.01
R7477:Adam26a UTSW 8 43569070 missense probably damaging 1.00
R7552:Adam26a UTSW 8 43569970 missense possibly damaging 0.77
R7670:Adam26a UTSW 8 43570153 missense probably benign 0.13
R7918:Adam26a UTSW 8 43569529 missense probably damaging 0.98
R8193:Adam26a UTSW 8 43569236 missense probably damaging 1.00
R8262:Adam26a UTSW 8 43569141 nonsense probably null
Z1088:Adam26a UTSW 8 43569698 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aacatacatacacacacacacac -3'
Posted On2013-10-16