Incidental Mutation 'R0830:Sash1'
ID77498
Institutional Source Beutler Lab
Gene Symbol Sash1
Ensembl Gene ENSMUSG00000015305
Gene NameSAM and SH3 domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location8722219-8886070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8729909 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 906 (V906M)
Ref Sequence ENSEMBL: ENSMUSP00000015449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015449]
Predicted Effect probably benign
Transcript: ENSMUST00000015449
AA Change: V906M

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000015449
Gene: ENSMUSG00000015305
AA Change: V906M

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
coiled coil region 185 212 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
Pfam:SLY 394 548 1.2e-46 PFAM
SH3 550 607 1.16e-3 SMART
SAM 623 690 1.83e-11 SMART
low complexity region 1008 1021 N/A INTRINSIC
SAM 1157 1224 3.6e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein involved in the TLR4 signaling pathway that may stimulate cytokine production and endothelial cell migration in response to invading pathogens. The encoded protein has also been described as a potential tumor suppressor that may negatively regulate proliferation, apoptosis, and invasion of cancer cells, and reduced expression of this gene has been observed in multiple human cancers. Mutations in this gene may be associated with abnormal skin pigmentation in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Sash1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Sash1 APN 10 8751413 missense probably damaging 1.00
IGL01535:Sash1 APN 10 8741577 missense probably damaging 1.00
IGL01537:Sash1 APN 10 8729658 missense probably damaging 1.00
IGL01788:Sash1 APN 10 8733646 missense probably benign 0.01
IGL01933:Sash1 APN 10 8751133 missense probably damaging 0.99
IGL02126:Sash1 APN 10 8739465 missense probably damaging 0.96
IGL02285:Sash1 APN 10 8740334 missense probably damaging 0.99
IGL02400:Sash1 APN 10 8733647 nonsense probably null
IGL02504:Sash1 APN 10 8729912 missense probably benign 0.00
IGL02630:Sash1 APN 10 8744535 missense probably benign 0.06
R0592:Sash1 UTSW 10 8729782 missense probably benign 0.00
R0647:Sash1 UTSW 10 8729552 missense probably damaging 0.99
R0656:Sash1 UTSW 10 8751137 critical splice donor site probably null
R0919:Sash1 UTSW 10 8730079 missense probably benign 0.01
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1470:Sash1 UTSW 10 8789593 missense probably damaging 1.00
R1606:Sash1 UTSW 10 8729957 missense probably benign 0.00
R1707:Sash1 UTSW 10 8730377 missense probably benign 0.00
R1922:Sash1 UTSW 10 8727908 missense possibly damaging 0.62
R1940:Sash1 UTSW 10 8729932 missense probably benign
R1964:Sash1 UTSW 10 8729713 missense probably benign 0.01
R2013:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2014:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2015:Sash1 UTSW 10 8729413 missense probably benign 0.03
R2074:Sash1 UTSW 10 8756697 missense probably damaging 1.00
R2252:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2253:Sash1 UTSW 10 8729977 missense probably benign 0.01
R2260:Sash1 UTSW 10 8786378 nonsense probably null
R3085:Sash1 UTSW 10 8742422 splice site probably null
R4024:Sash1 UTSW 10 8729917 missense probably benign 0.00
R4039:Sash1 UTSW 10 8729627 missense probably damaging 1.00
R4290:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4292:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4295:Sash1 UTSW 10 8730242 missense possibly damaging 0.59
R4301:Sash1 UTSW 10 8751470 missense probably benign 0.00
R4657:Sash1 UTSW 10 8725660 missense probably damaging 1.00
R4669:Sash1 UTSW 10 8730385 missense probably benign 0.00
R4719:Sash1 UTSW 10 8729713 missense probably benign 0.01
R4745:Sash1 UTSW 10 8729908 missense probably benign
R5197:Sash1 UTSW 10 8740225 missense probably damaging 1.00
R5217:Sash1 UTSW 10 8780604 missense possibly damaging 0.63
R5420:Sash1 UTSW 10 8746186 missense probably damaging 1.00
R5591:Sash1 UTSW 10 8725718 missense probably benign 0.36
R6505:Sash1 UTSW 10 8729527 missense probably benign 0.21
R6679:Sash1 UTSW 10 8740185 missense probably damaging 1.00
R6761:Sash1 UTSW 10 8744522 missense probably damaging 0.99
R6885:Sash1 UTSW 10 8784221 missense probably damaging 1.00
R6980:Sash1 UTSW 10 8729848 missense probably benign 0.00
R7034:Sash1 UTSW 10 8730083 nonsense probably null
R7036:Sash1 UTSW 10 8730083 nonsense probably null
R7088:Sash1 UTSW 10 8729717 nonsense probably null
R7289:Sash1 UTSW 10 8730196 missense probably damaging 0.99
R7464:Sash1 UTSW 10 8756745 missense possibly damaging 0.82
R7661:Sash1 UTSW 10 8729391 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGCTTGTTCTCCGTGAGCATC -3'
(R):5'- TGTACCAGAAGTGCCGCAGAAGAC -3'

Sequencing Primer
(F):5'- ACCAAGTGCAGGCCATTG -3'
(R):5'- ACGTCTGCCTGCACCTC -3'
Posted On2013-10-16