Incidental Mutation 'R0830:E2f3'
ID77502
Institutional Source Beutler Lab
Gene Symbol E2f3
Ensembl Gene ENSMUSG00000016477
Gene NameE2F transcription factor 3
SynonymsE2F3b, E2f3a
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location29906575-29986063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29985560 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 37 (A37T)
Ref Sequence ENSEMBL: ENSMUSP00000100012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102948] [ENSMUST00000221536] [ENSMUST00000222730]
Predicted Effect probably benign
Transcript: ENSMUST00000102948
AA Change: A37T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100012
Gene: ENSMUSG00000016477
AA Change: A37T

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
E2F_TDP 170 235 3.53e-35 SMART
Pfam:E2F_CC-MB 251 344 5.1e-38 PFAM
low complexity region 417 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146092
Predicted Effect probably benign
Transcript: ENSMUST00000221536
Predicted Effect probably benign
Transcript: ENSMUST00000222730
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lethality prior to adulthood but otherwise appear normal. Mouse embryonic fibroblast cells from mice homozygous for a null allele are defective in cell cycle progression and exhibit reduced proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in E2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:E2f3 APN 13 29918704 missense probably damaging 1.00
IGL00774:E2f3 APN 13 29918704 missense probably damaging 1.00
IGL02541:E2f3 APN 13 29916844 critical splice donor site probably null
IGL02669:E2f3 APN 13 29916991 missense probably benign 0.00
IGL03119:E2f3 APN 13 29985365 missense probably benign 0.21
Hillside UTSW 13 29918669 missense probably damaging 1.00
Slippery UTSW 13 29918585 missense possibly damaging 0.94
R0948:E2f3 UTSW 13 29985533 missense probably damaging 0.99
R1442:E2f3 UTSW 13 29918669 missense probably damaging 1.00
R1813:E2f3 UTSW 13 29920176 missense probably damaging 0.97
R2496:E2f3 UTSW 13 29911306 missense probably damaging 1.00
R4715:E2f3 UTSW 13 29911275 missense probably damaging 1.00
R5202:E2f3 UTSW 13 29918636 missense probably damaging 1.00
R5902:E2f3 UTSW 13 29985267 unclassified probably benign
R6796:E2f3 UTSW 13 29918585 missense possibly damaging 0.94
R7546:E2f3 UTSW 13 29910129 missense probably damaging 0.98
R7705:E2f3 UTSW 13 29985323 missense probably benign 0.39
R7779:E2f3 UTSW 13 29918615 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAAGAGGGACTCCCCACTGC -3'
(R):5'- GAGACTTGGAAACTCCGGCTGC -3'

Sequencing Primer
(F):5'- CGCTGAGGAGGGTATTACCG -3'
(R):5'- ACTCCGGCTGCAAATAATAAAAG -3'
Posted On2013-10-16