Incidental Mutation 'R0830:Flywch1'
ID77507
Institutional Source Beutler Lab
Gene Symbol Flywch1
Ensembl Gene ENSMUSG00000040097
Gene NameFLYWCH-type zinc finger 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23752793-23771602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23762370 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 160 (K160E)
Ref Sequence ENSEMBL: ENSMUSP00000083505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045517] [ENSMUST00000086325] [ENSMUST00000226460]
Predicted Effect probably benign
Transcript: ENSMUST00000045517
AA Change: K160E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000040022
Gene: ENSMUSG00000040097
AA Change: K160E

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 83 1.2e-24 PFAM
Pfam:FLYWCH 92 150 7e-17 PFAM
Pfam:FLYWCH 235 293 3.3e-17 PFAM
low complexity region 352 380 N/A INTRINSIC
low complexity region 381 394 N/A INTRINSIC
Pfam:FLYWCH 402 460 9.7e-18 PFAM
Pfam:FLYWCH 490 548 7.9e-18 PFAM
Pfam:FLYWCH 581 639 6.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086325
AA Change: K160E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000083505
Gene: ENSMUSG00000040097
AA Change: K160E

DomainStartEndE-ValueType
Pfam:FLYWCH_N 1 84 9.7e-10 PFAM
Pfam:FLYWCH 92 150 3.8e-17 PFAM
Pfam:FLYWCH 235 293 3.1e-17 PFAM
Pfam:FLYWCH_u 294 401 1.3e-30 PFAM
Pfam:FLYWCH 402 460 9.1e-18 PFAM
Pfam:FLYWCH 490 548 6.8e-18 PFAM
Pfam:FLYWCH_u 549 568 9.1e-3 PFAM
Pfam:FLYWCH 581 639 4.7e-17 PFAM
Pfam:FLYWCH_u 640 672 4.6e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226460
Predicted Effect unknown
Transcript: ENSMUST00000227120
AA Change: K113E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228934
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Flywch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Flywch1 APN 17 23763026 missense probably benign 0.01
IGL01843:Flywch1 APN 17 23760345 missense possibly damaging 0.89
IGL02110:Flywch1 APN 17 23763092 unclassified probably null
IGL02586:Flywch1 APN 17 23755702 missense probably benign 0.04
IGL02870:Flywch1 APN 17 23755902 missense probably damaging 1.00
IGL02877:Flywch1 APN 17 23760414 missense probably damaging 1.00
lubdub UTSW 17 23761059 missense possibly damaging 0.93
R1411:Flywch1 UTSW 17 23755824 missense probably damaging 1.00
R2044:Flywch1 UTSW 17 23762313 nonsense probably null
R2153:Flywch1 UTSW 17 23755650 missense probably benign 0.21
R2314:Flywch1 UTSW 17 23763026 missense probably benign 0.01
R2497:Flywch1 UTSW 17 23755711 missense probably benign 0.27
R3022:Flywch1 UTSW 17 23763108 missense probably benign 0.00
R3625:Flywch1 UTSW 17 23760201 splice site probably benign
R3691:Flywch1 UTSW 17 23763212 missense probably damaging 0.96
R4805:Flywch1 UTSW 17 23760617 missense probably benign 0.16
R5321:Flywch1 UTSW 17 23756651 missense probably damaging 1.00
R7148:Flywch1 UTSW 17 23755675 missense probably benign 0.01
R7200:Flywch1 UTSW 17 23761059 missense possibly damaging 0.93
R7629:Flywch1 UTSW 17 23755770 missense probably benign 0.06
RF003:Flywch1 UTSW 17 23762166 frame shift probably null
RF007:Flywch1 UTSW 17 23762164 frame shift probably null
RF007:Flywch1 UTSW 17 23762171 frame shift probably null
RF009:Flywch1 UTSW 17 23762161 frame shift probably null
RF010:Flywch1 UTSW 17 23762175 frame shift probably null
RF013:Flywch1 UTSW 17 23762175 frame shift probably null
RF018:Flywch1 UTSW 17 23762166 frame shift probably null
RF022:Flywch1 UTSW 17 23762167 frame shift probably null
RF027:Flywch1 UTSW 17 23762158 frame shift probably null
RF031:Flywch1 UTSW 17 23762158 frame shift probably null
RF038:Flywch1 UTSW 17 23762164 frame shift probably null
RF040:Flywch1 UTSW 17 23762169 frame shift probably null
RF041:Flywch1 UTSW 17 23762161 frame shift probably null
RF041:Flywch1 UTSW 17 23762177 frame shift probably null
RF046:Flywch1 UTSW 17 23762169 frame shift probably null
RF046:Flywch1 UTSW 17 23762174 frame shift probably null
RF049:Flywch1 UTSW 17 23762171 frame shift probably null
RF058:Flywch1 UTSW 17 23762177 frame shift probably null
X0009:Flywch1 UTSW 17 23755655 small deletion probably benign
X0028:Flywch1 UTSW 17 23761095 missense probably damaging 1.00
Z1176:Flywch1 UTSW 17 23761009 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGCCGTCTGACCTGTGGACTAATG -3'
(R):5'- TTCCTGTACAAGCAAGAGAAGGCTG -3'

Sequencing Primer
(F):5'- GACTTACAGCACATTTTGAGAACC -3'
(R):5'- GTGGGGGACAAGGTGTACTG -3'
Posted On2013-10-16