Incidental Mutation 'R0830:Bnip1'
ID77508
Institutional Source Beutler Lab
Gene Symbol Bnip1
Ensembl Gene ENSMUSG00000024191
Gene NameBCL2/adenovirus E1B interacting protein 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0830 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location26781079-26792565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26789705 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 94 (S94P)
Ref Sequence ENSEMBL: ENSMUSP00000015725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015725] [ENSMUST00000126505] [ENSMUST00000135824]
Predicted Effect probably benign
Transcript: ENSMUST00000015725
AA Change: S94P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015725
Gene: ENSMUSG00000024191
AA Change: S94P

DomainStartEndE-ValueType
coiled coil region 37 89 N/A INTRINSIC
Pfam:Sec20 133 224 2.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131362
Predicted Effect unknown
Transcript: ENSMUST00000134344
AA Change: S84P
SMART Domains Protein: ENSMUSP00000122734
Gene: ENSMUSG00000024191
AA Change: S84P

DomainStartEndE-ValueType
coiled coil region 27 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135824
SMART Domains Protein: ENSMUSP00000118933
Gene: ENSMUSG00000024191

DomainStartEndE-ValueType
coiled coil region 37 90 N/A INTRINSIC
Pfam:Sec20 99 190 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135899
Predicted Effect unknown
Transcript: ENSMUST00000137989
AA Change: L41P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147516
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. In addition, this protein is involved in vesicle transport into the endoplasmic reticulum. Alternative splicing of this gene results in four protein products with identical N- and C-termini. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Bnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4918:Bnip1 UTSW 17 26783551 splice site probably benign
R5340:Bnip1 UTSW 17 26786790 critical splice donor site probably null
R6329:Bnip1 UTSW 17 26786710 nonsense probably null
R6522:Bnip1 UTSW 17 26789745 missense probably damaging 0.96
X0063:Bnip1 UTSW 17 26786784 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCAGACACTCGTCAGGCAGTAAAG -3'
(R):5'- GAGACCAGACTGGGATGTATGAGACTC -3'

Sequencing Primer
(F):5'- CGTGTCTAGCAAAGTACCATGTC -3'
(R):5'- gatgtatgagactcggtatcaaaac -3'
Posted On2013-10-16