Incidental Mutation 'R0830:Olfr122'
ID77509
Institutional Source Beutler Lab
Gene Symbol Olfr122
Ensembl Gene ENSMUSG00000083947
Gene Nameolfactory receptor 122
SynonymsMOR263-10, GA_x6K02T2PSCP-2230932-2231897
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37768607-37773749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37771913 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 87 (M87L)
Ref Sequence ENSEMBL: ENSMUSP00000149334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119082] [ENSMUST00000172582] [ENSMUST00000217119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119082
AA Change: M96L

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113170
Gene: ENSMUSG00000083947
AA Change: M96L

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 50 320 2.7e-6 PFAM
Pfam:7tm_1 56 305 3.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172582
AA Change: M87L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134283
Gene: ENSMUSG00000083947
AA Change: M87L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 41 311 9.5e-8 PFAM
Pfam:7tm_1 47 296 7.8e-36 PFAM
Pfam:7tm_4 145 289 1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215449
Predicted Effect probably damaging
Transcript: ENSMUST00000217119
AA Change: M87L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Olfr122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Olfr122 APN 17 37772614 missense probably benign 0.00
IGL01338:Olfr122 APN 17 37771839 missense possibly damaging 0.90
IGL01447:Olfr122 APN 17 37772231 missense probably damaging 1.00
PIT4514001:Olfr122 UTSW 17 37771867 missense probably damaging 1.00
R0402:Olfr122 UTSW 17 37772393 missense probably damaging 1.00
R2018:Olfr122 UTSW 17 37772576 missense probably benign 0.00
R4258:Olfr122 UTSW 17 37772058 missense probably damaging 1.00
R6371:Olfr122 UTSW 17 37772435 missense probably benign
R6481:Olfr122 UTSW 17 37772303 missense probably damaging 1.00
R7468:Olfr122 UTSW 17 37772019 missense probably damaging 1.00
R7492:Olfr122 UTSW 17 37771680 missense possibly damaging 0.53
R8114:Olfr122 UTSW 17 37771989 missense possibly damaging 0.67
R8172:Olfr122 UTSW 17 37772435 missense probably benign
Z1177:Olfr122 UTSW 17 37772191 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAACGCTTTGCATTTGCCAAGTTC -3'
(R):5'- CAGGGTCCACAGAAGTTCAACGAG -3'

Sequencing Primer
(F):5'- CTCTGAGGTCCCTGGAGAATG -3'
(R):5'- TAAAATTGGTCTGTCCCAACCC -3'
Posted On2013-10-16