Incidental Mutation 'R0830:Emilin2'
ID77510
Institutional Source Beutler Lab
Gene Symbol Emilin2
Ensembl Gene ENSMUSG00000024053
Gene Nameelastin microfibril interfacer 2
SynonymsFOAP-10, basilin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71252176-71310965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71273820 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 637 (M637T)
Ref Sequence ENSEMBL: ENSMUSP00000024849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024849]
Predicted Effect probably benign
Transcript: ENSMUST00000024849
AA Change: M637T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024849
Gene: ENSMUSG00000024053
AA Change: M637T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:EMI 48 118 1.2e-18 PFAM
coiled coil region 181 216 N/A INTRINSIC
coiled coil region 259 308 N/A INTRINSIC
coiled coil region 590 618 N/A INTRINSIC
low complexity region 809 826 N/A INTRINSIC
low complexity region 833 848 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
Pfam:C1q 928 1067 5.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disruptions in platelet activation, thrombus formation and clot retraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Emilin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Emilin2 APN 17 71252859 missense possibly damaging 0.80
IGL01294:Emilin2 APN 17 71274594 missense probably benign 0.07
IGL02085:Emilin2 APN 17 71275149 missense probably damaging 0.99
IGL02433:Emilin2 APN 17 71274129 missense probably benign
IGL02587:Emilin2 APN 17 71280856 splice site probably benign
IGL02639:Emilin2 APN 17 71274549 missense probably benign 0.00
IGL02798:Emilin2 APN 17 71256695 splice site probably benign
IGL02952:Emilin2 APN 17 71280821 missense probably damaging 0.99
IGL02954:Emilin2 APN 17 71256531 missense probably benign 0.37
PIT4431001:Emilin2 UTSW 17 71255995 missense probably benign 0.16
PIT4802001:Emilin2 UTSW 17 71273469 missense probably damaging 1.00
R0011:Emilin2 UTSW 17 71273868 missense probably benign 0.01
R0033:Emilin2 UTSW 17 71275014 missense probably benign 0.27
R0784:Emilin2 UTSW 17 71275287 missense possibly damaging 0.83
R1301:Emilin2 UTSW 17 71255965 splice site probably benign
R1394:Emilin2 UTSW 17 71253071 missense possibly damaging 0.79
R1501:Emilin2 UTSW 17 71310761 missense probably benign
R1576:Emilin2 UTSW 17 71255117 critical splice donor site probably null
R1676:Emilin2 UTSW 17 71274090 missense probably benign 0.14
R2063:Emilin2 UTSW 17 71274955 missense probably benign
R2149:Emilin2 UTSW 17 71273992 missense probably benign 0.06
R2238:Emilin2 UTSW 17 71274739 missense possibly damaging 0.83
R2239:Emilin2 UTSW 17 71310224 missense probably benign 0.00
R2380:Emilin2 UTSW 17 71310224 missense probably benign 0.00
R2420:Emilin2 UTSW 17 71274279 missense possibly damaging 0.90
R3721:Emilin2 UTSW 17 71273454 missense probably benign 0.12
R4176:Emilin2 UTSW 17 71274263 missense probably benign 0.00
R4348:Emilin2 UTSW 17 71280731 missense probably benign
R4352:Emilin2 UTSW 17 71280731 missense probably benign
R4695:Emilin2 UTSW 17 71252778 missense probably damaging 1.00
R4807:Emilin2 UTSW 17 71273448 missense probably damaging 0.98
R4980:Emilin2 UTSW 17 71253071 missense possibly damaging 0.79
R5028:Emilin2 UTSW 17 71274732 missense possibly damaging 0.91
R5048:Emilin2 UTSW 17 71273967 missense probably damaging 1.00
R5153:Emilin2 UTSW 17 71273502 missense possibly damaging 0.83
R5519:Emilin2 UTSW 17 71252935 missense probably benign 0.12
R5580:Emilin2 UTSW 17 71275230 missense probably benign
R6088:Emilin2 UTSW 17 71255124 missense probably benign
R6248:Emilin2 UTSW 17 71274117 missense probably benign 0.04
R6429:Emilin2 UTSW 17 71310956 start gained probably benign
R7085:Emilin2 UTSW 17 71274105 missense probably damaging 1.00
R7260:Emilin2 UTSW 17 71274790 missense probably benign 0.00
R7525:Emilin2 UTSW 17 71274979 missense probably benign
R7671:Emilin2 UTSW 17 71273910 missense probably benign 0.00
R7895:Emilin2 UTSW 17 71273913 missense probably benign 0.03
R8257:Emilin2 UTSW 17 71274000 missense probably benign
R8310:Emilin2 UTSW 17 71255146 missense probably damaging 1.00
R8311:Emilin2 UTSW 17 71255146 missense probably damaging 1.00
X0064:Emilin2 UTSW 17 71280703 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGACTCCCTGAGATGGTATCC -3'
(R):5'- ACGATGCACAGGCAGTTCCAAG -3'

Sequencing Primer
(F):5'- GAGATGGTATCCAGCCTTCTGC -3'
(R):5'- GCAGTTCCAAGAAACGAGTC -3'
Posted On2013-10-16