Incidental Mutation 'R0830:Irak1'
ID77512
Institutional Source Beutler Lab
Gene Symbol Irak1
Ensembl Gene ENSMUSG00000031392
Gene Nameinterleukin-1 receptor-associated kinase 1
SynonymsIRAK-1, Il1rak, Plpk, mPLK
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
ChromosomeX
Chromosomal Location74013914-74023918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74016583 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 679 (D679G)
Ref Sequence ENSEMBL: ENSMUSP00000110000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033769] [ENSMUST00000068286] [ENSMUST00000101458] [ENSMUST00000114352] [ENSMUST00000114353] [ENSMUST00000114354] [ENSMUST00000114360] [ENSMUST00000126583] [ENSMUST00000128436]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033769
AA Change: D719G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033769
Gene: ENSMUSG00000031392
AA Change: D719G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Death 28 103 3e-14 PFAM
low complexity region 104 123 N/A INTRINSIC
low complexity region 158 189 N/A INTRINSIC
Pfam:Pkinase_Tyr 213 518 5.5e-36 PFAM
Pfam:Pkinase 213 522 4.2e-40 PFAM
low complexity region 607 616 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068286
AA Change: D679G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064448
Gene: ENSMUSG00000031392
AA Change: D679G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Death 28 103 4.4e-13 PFAM
low complexity region 104 123 N/A INTRINSIC
low complexity region 158 188 N/A INTRINSIC
Pfam:Pkinase 212 518 5.1e-41 PFAM
Pfam:Pkinase_Tyr 212 518 6.3e-37 PFAM
low complexity region 567 576 N/A INTRINSIC
low complexity region 640 654 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101458
AA Change: D652G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099001
Gene: ENSMUSG00000031392
AA Change: D652G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Death 28 103 4.1e-13 PFAM
low complexity region 104 123 N/A INTRINSIC
low complexity region 158 188 N/A INTRINSIC
Pfam:Pkinase 212 516 1.3e-40 PFAM
Pfam:Pkinase_Tyr 212 517 1.9e-36 PFAM
low complexity region 540 549 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114352
AA Change: D679G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109992
Gene: ENSMUSG00000031392
AA Change: D679G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Death 28 103 4.4e-13 PFAM
low complexity region 104 123 N/A INTRINSIC
low complexity region 158 188 N/A INTRINSIC
Pfam:Pkinase 212 518 5.1e-41 PFAM
Pfam:Pkinase_Tyr 212 518 6.3e-37 PFAM
low complexity region 567 576 N/A INTRINSIC
low complexity region 640 654 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114353
AA Change: D600G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109993
Gene: ENSMUSG00000031392
AA Change: D600G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Death 28 103 1e-10 PFAM
low complexity region 104 123 N/A INTRINSIC
low complexity region 158 188 N/A INTRINSIC
S_TKc 212 537 6.6e-15 SMART
low complexity region 561 575 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114354
AA Change: D680G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109994
Gene: ENSMUSG00000031392
AA Change: D680G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Death 28 103 1.5e-12 PFAM
low complexity region 104 123 N/A INTRINSIC
low complexity region 158 189 N/A INTRINSIC
Pfam:Pkinase 213 519 6e-41 PFAM
Pfam:Pkinase_Tyr 213 519 7.4e-37 PFAM
low complexity region 568 577 N/A INTRINSIC
low complexity region 641 655 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114360
AA Change: D679G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110000
Gene: ENSMUSG00000031392
AA Change: D679G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Death 28 103 4.4e-13 PFAM
low complexity region 104 123 N/A INTRINSIC
low complexity region 158 188 N/A INTRINSIC
Pfam:Pkinase 212 518 5.1e-41 PFAM
Pfam:Pkinase_Tyr 212 518 6.3e-37 PFAM
low complexity region 567 576 N/A INTRINSIC
low complexity region 640 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126583
SMART Domains Protein: ENSMUSP00000115508
Gene: ENSMUSG00000031392

DomainStartEndE-ValueType
Pfam:Pkinase 1 261 1.7e-29 PFAM
Pfam:Pkinase_Tyr 1 261 3.2e-31 PFAM
low complexity region 310 319 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128436
AA Change: I132V
SMART Domains Protein: ENSMUSP00000118570
Gene: ENSMUSG00000031392
AA Change: I132V

DomainStartEndE-ValueType
SCOP:d1qpca_ 63 93 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132144
SMART Domains Protein: ENSMUSP00000117042
Gene: ENSMUSG00000031392

DomainStartEndE-ValueType
low complexity region 22 53 N/A INTRINSIC
SCOP:d1b6cb_ 60 109 2e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138397
AA Change: D245G
SMART Domains Protein: ENSMUSP00000121016
Gene: ENSMUSG00000031392
AA Change: D245G

DomainStartEndE-ValueType
Pfam:Pkinase 1 145 9.7e-18 PFAM
Pfam:Pkinase_Tyr 2 125 2.5e-13 PFAM
low complexity region 207 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140130
Predicted Effect probably benign
Transcript: ENSMUST00000148317
SMART Domains Protein: ENSMUSP00000122519
Gene: ENSMUSG00000031392

DomainStartEndE-ValueType
SCOP:d1ir3a_ 32 98 1e-6 SMART
low complexity region 123 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149871
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the interleukin-1 receptor-associated kinase 1, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. This gene is partially responsible for IL1-induced upregulation of the transcription factor NF-kappa B. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Cytokine production and response to endotoxin are attenuated however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Il18rap T A 1: 40,542,990 V357E probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Irak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2114:Irak1 UTSW X 74022612 missense possibly damaging 0.89
R2115:Irak1 UTSW X 74022612 missense possibly damaging 0.89
R2117:Irak1 UTSW X 74022612 missense possibly damaging 0.89
R2202:Irak1 UTSW X 74017138 missense probably damaging 0.99
R2205:Irak1 UTSW X 74017138 missense probably damaging 0.99
R4679:Irak1 UTSW X 74022389 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTATGCCTGTATGCCCTGGAGCTG -3'
(R):5'- TCTGGAGGCTAGAGTGTCACTCAAG -3'

Sequencing Primer
(F):5'- TATCCACAGGTACCTGGGAA -3'
(R):5'- CATCCCTGCTGTCATCAGAA -3'
Posted On2013-10-16