Incidental Mutation 'R0831:Cadps2'
ID 77532
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 039010-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0831 (G1)
Quality Score 193
Status Validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23321739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 1051 (S1051N)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: S1101N

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: S1101N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000069074
AA Change: S1094N

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: S1094N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115358
AA Change: S1061N

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: S1061N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115361
AA Change: S1051N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: S1051N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125350
AA Change: S696N

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: S696N

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: S1072N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: S1072N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163871
AA Change: S1101N

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: S1101N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: S1072N

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: S1072N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156986
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik C T 7: 12,284,523 (GRCm39) probably benign Het
3425401B19Rik T C 14: 32,384,228 (GRCm39) N579S probably benign Het
Adck1 G T 12: 88,335,118 (GRCm39) M1I probably null Het
Adgra3 A T 5: 50,128,144 (GRCm39) I779N probably damaging Het
Adgrf2 A G 17: 43,021,334 (GRCm39) S497P probably damaging Het
Afg3l2 A C 18: 67,554,297 (GRCm39) F468L probably damaging Het
Alms1 T A 6: 85,605,502 (GRCm39) I2384N probably benign Het
Ankrd13b A T 11: 77,363,585 (GRCm39) S244R probably damaging Het
Aox1 T A 1: 58,378,842 (GRCm39) H1030Q probably benign Het
Ap1b1 A G 11: 4,973,092 (GRCm39) probably benign Het
Atxn2l A G 7: 126,098,332 (GRCm39) S187P probably damaging Het
B4galt4 G T 16: 38,588,341 (GRCm39) E57D probably benign Het
Cad T C 5: 31,224,944 (GRCm39) V949A probably damaging Het
Ccdc66 C T 14: 27,219,313 (GRCm39) V148I probably benign Het
Ccser1 C T 6: 61,400,045 (GRCm39) P55S probably damaging Het
Cds2 T C 2: 132,127,887 (GRCm39) probably null Het
Cep95 A G 11: 106,705,530 (GRCm39) D548G probably benign Het
Chil3 A G 3: 106,057,063 (GRCm39) Y294H probably benign Het
Chmp5 A G 4: 40,949,500 (GRCm39) D39G probably damaging Het
Chrd T A 16: 20,560,059 (GRCm39) F887I probably damaging Het
Col24a1 G T 3: 145,034,520 (GRCm39) G580V probably damaging Het
Col6a2 A T 10: 76,439,939 (GRCm39) N655K probably damaging Het
Ctsf A T 19: 4,909,868 (GRCm39) Y416F possibly damaging Het
Dennd5a A C 7: 109,533,961 (GRCm39) V77G probably damaging Het
Dna2 A T 10: 62,795,108 (GRCm39) K460* probably null Het
Dnah17 A T 11: 117,951,097 (GRCm39) M2842K probably damaging Het
Dnajc13 C A 9: 104,049,811 (GRCm39) G1765V probably damaging Het
Donson A C 16: 91,480,651 (GRCm39) C243W probably damaging Het
Dpp8 A T 9: 64,985,961 (GRCm39) N817I possibly damaging Het
Eef1d G A 15: 75,768,655 (GRCm39) probably benign Het
Esf1 T A 2: 140,010,279 (GRCm39) D19V probably damaging Het
Gm21738 T A 14: 19,415,957 (GRCm38) Y194F probably benign Het
Gm21738 T C 14: 19,415,963 (GRCm38) K192R probably benign Het
Gm9867 C A 4: 140,049,799 (GRCm39) A128S unknown Het
Igsf23 G T 7: 19,675,662 (GRCm39) probably benign Het
Inhca T C 9: 103,146,978 (GRCm39) H292R possibly damaging Het
Kdm7a C A 6: 39,143,699 (GRCm39) probably benign Het
Kif14 G A 1: 136,453,609 (GRCm39) probably benign Het
Mroh7 T C 4: 106,537,990 (GRCm39) N1229D possibly damaging Het
Mrps11 C A 7: 78,441,611 (GRCm39) probably benign Het
Mtmr2 T A 9: 13,707,409 (GRCm39) D248E probably damaging Het
Myrfl C A 10: 116,619,114 (GRCm39) S748I probably benign Het
Nop14 T C 5: 34,807,864 (GRCm39) E366G possibly damaging Het
Or13c3 T G 4: 52,855,764 (GRCm39) I250L possibly damaging Het
Or2w25 C T 11: 59,504,480 (GRCm39) T230I possibly damaging Het
Or52z13 A G 7: 103,247,338 (GRCm39) I272V probably benign Het
Or7e177 T A 9: 20,211,861 (GRCm39) C123S probably benign Het
Or8g2b C T 9: 39,751,579 (GRCm39) P283L probably damaging Het
Phykpl G T 11: 51,476,366 (GRCm39) E29* probably null Het
Plppr4 A G 3: 117,125,295 (GRCm39) probably null Het
Prmt2 A C 10: 76,043,641 (GRCm39) probably benign Het
Prodh2 T A 7: 30,193,649 (GRCm39) Y114* probably null Het
Prr23a2 C A 9: 98,738,917 (GRCm39) H92N probably damaging Het
Rasl10b G A 11: 83,308,665 (GRCm39) probably null Het
Rdx C A 9: 51,977,117 (GRCm39) A122E probably damaging Het
Rspo3 T G 10: 29,330,253 (GRCm39) D236A unknown Het
Sdk2 A T 11: 113,723,084 (GRCm39) D1302E probably damaging Het
Sipa1 A T 19: 5,710,382 (GRCm39) D209E probably damaging Het
Sirpa T G 2: 129,469,856 (GRCm39) probably benign Het
Ska1 A C 18: 74,330,570 (GRCm39) probably benign Het
Slc4a9 T C 18: 36,668,331 (GRCm39) probably benign Het
Slco1b2 T C 6: 141,631,172 (GRCm39) V602A probably benign Het
Slco2a1 T C 9: 102,959,533 (GRCm39) V543A probably damaging Het
Sorcs3 A T 19: 48,682,433 (GRCm39) L489F probably damaging Het
Sorl1 T C 9: 41,982,365 (GRCm39) probably benign Het
Sp140l1 C G 1: 85,077,226 (GRCm39) K113N probably benign Het
Spindoc G T 19: 7,352,100 (GRCm39) N82K probably benign Het
Stk17b C A 1: 53,796,651 (GRCm39) C372F probably damaging Het
Tbck A G 3: 132,428,052 (GRCm39) probably benign Het
Thoc1 C T 18: 9,963,267 (GRCm39) T127I probably benign Het
Togaram2 G T 17: 72,023,439 (GRCm39) R765L probably damaging Het
Tprg1 A G 16: 25,136,219 (GRCm39) Y70C probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Umodl1 T C 17: 31,215,325 (GRCm39) Y1050H probably damaging Het
Vmn1r205 T A 13: 22,776,586 (GRCm39) D172V probably benign Het
Vmn1r79 A T 7: 11,910,990 (GRCm39) N291Y probably damaging Het
Vmn2r112 T A 17: 22,833,980 (GRCm39) N549K probably damaging Het
Vrk3 T A 7: 44,414,227 (GRCm39) L241Q probably damaging Het
Zc3h7a A G 16: 10,969,744 (GRCm39) S386P probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGGCTTACCATTTTGCTCAGCCAA -3'
(R):5'- GTGAAACGTGCTTGAACCATTTTCTTCT -3'

Sequencing Primer
(F):5'- TGGATGCAAACTCTGAGTCTTC -3'
(R):5'- GTCTAACCTTTATTTGAGATGCCAGC -3'
Posted On 2013-10-16