Mutagenetix > Incidental Mutation

Incidental Mutation 'R0831:Cadps2'

77532

Institutional Source

Beutler Lab

Gene Symbol

Cadps2

Ensembl Gene

ENSMUSG00000017978

Gene Name

Ca2+-dependent activator protein for secretion 2

Synonyms

Caps2, cpd2, A230044C21Rik

MMRRC Submission

039010-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0831 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

23262773-23839421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 23321740 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 1051 (S1051N)

Ref Sequence

ENSEMBL: ENSMUSP00000111018 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000018122
AA Change: S1101N

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: S1101N

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069074
AA Change: S1094N

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: S1094N

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	895	5.54e-51	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115358
AA Change: S1061N

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: S1061N

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	1.14e-52	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115361
AA Change: S1051N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: S1051N

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	892	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125350
AA Change: S696N

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: S696N

Domain	Start	End	E-Value	Type
C2	14	112	1.51e-1	SMART
PH	137	241	2.94e-11	SMART
DUF1041	446	537	1.9e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142913
AA Change: S1072N

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: S1072N

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	22	39	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.14e-52	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156986

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163871
AA Change: S1101N

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: S1101N

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	31	65	N/A	INTRINSIC
low complexity region	114	126	N/A	INTRINSIC
coiled coil region	265	285	N/A	INTRINSIC
C2	369	467	1.51e-1	SMART
PH	492	596	2.94e-11	SMART
DUF1041	801	902	7.2e-50	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166458
AA Change: S1072N

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: S1072N

Domain	Start	End	E-Value	Type
low complexity region	5	21	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
coiled coil region	236	256	N/A	INTRINSIC
C2	340	438	1.51e-1	SMART
PH	463	567	2.94e-11	SMART
DUF1041	772	873	1.05e-51	SMART

Meta Mutation Damage Score

0.0600

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.0%

Validation Efficiency

95% (82/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,269,779	H292R	possibly damaging	Het
2900092C05Rik	C	T	7: 12,550,596		probably benign	Het
3425401B19Rik	T	C	14: 32,662,271	N579S	probably benign	Het
A530032D15Rik	C	G	1: 85,099,505	K113N	probably benign	Het
Adck1	G	T	12: 88,368,348	M1I	probably null	Het
Adgra3	A	T	5: 49,970,802	I779N	probably damaging	Het
Adgrf2	A	G	17: 42,710,443	S497P	probably damaging	Het
Afg3l2	A	C	18: 67,421,227	F468L	probably damaging	Het
Alms1	T	A	6: 85,628,520	I2384N	probably benign	Het
Ankrd13b	A	T	11: 77,472,759	S244R	probably damaging	Het
Aox2	T	A	1: 58,339,683	H1030Q	probably benign	Het
Ap1b1	A	G	11: 5,023,092		probably benign	Het
Atxn2l	A	G	7: 126,499,160	S187P	probably damaging	Het
B4galt4	G	T	16: 38,767,979	E57D	probably benign	Het
Cad	T	C	5: 31,067,600	V949A	probably damaging	Het
Ccdc66	C	T	14: 27,497,356	V148I	probably benign	Het
Ccser1	C	T	6: 61,423,061	P55S	probably damaging	Het
Cds2	T	C	2: 132,285,967		probably null	Het
Cep95	A	G	11: 106,814,704	D548G	probably benign	Het
Chil3	A	G	3: 106,149,747	Y294H	probably benign	Het
Chmp5	A	G	4: 40,949,500	D39G	probably damaging	Het
Chrd	T	A	16: 20,741,309	F887I	probably damaging	Het
Col24a1	G	T	3: 145,328,759	G580V	probably damaging	Het
Col6a2	A	T	10: 76,604,105	N655K	probably damaging	Het
Ctsf	A	T	19: 4,859,840	Y416F	possibly damaging	Het
Dennd5a	A	C	7: 109,934,754	V77G	probably damaging	Het
Dna2	A	T	10: 62,959,329	K460*	probably null	Het
Dnah17	A	T	11: 118,060,271	M2842K	probably damaging	Het
Dnajc13	C	A	9: 104,172,612	G1765V	probably damaging	Het
Donson	A	C	16: 91,683,763	C243W	probably damaging	Het
Dpp8	A	T	9: 65,078,679	N817I	possibly damaging	Het
Eef1d	G	A	15: 75,896,806		probably benign	Het
Esf1	T	A	2: 140,168,359	D19V	probably damaging	Het
Gm21738	T	A	14: 19,415,957	Y194F	probably benign	Het
Gm21738	T	C	14: 19,415,963	K192R	probably benign	Het
Gm9867	C	A	4: 140,322,488	A128S	unknown	Het
Igsf23	G	T	7: 19,941,737		probably benign	Het
Kdm7a	C	A	6: 39,166,765		probably benign	Het
Kif14	G	A	1: 136,525,871		probably benign	Het
Mroh7	T	C	4: 106,680,793	N1229D	possibly damaging	Het
Mrps11	C	A	7: 78,791,863		probably benign	Het
Mtmr2	T	A	9: 13,796,113	D248E	probably damaging	Het
Myrfl	C	A	10: 116,783,209	S748I	probably benign	Het
Nop14	T	C	5: 34,650,520	E366G	possibly damaging	Het
Olfr225	C	T	11: 59,613,654	T230I	possibly damaging	Het
Olfr273	T	G	4: 52,855,764	I250L	possibly damaging	Het
Olfr618	A	G	7: 103,598,131	I272V	probably benign	Het
Olfr873	T	A	9: 20,300,565	C123S	probably benign	Het
Olfr971	C	T	9: 39,840,283	P283L	probably damaging	Het
Phykpl	G	T	11: 51,585,539	E29*	probably null	Het
Plppr4	A	G	3: 117,331,646		probably null	Het
Prmt2	A	C	10: 76,207,807		probably benign	Het
Prodh2	T	A	7: 30,494,224	Y114*	probably null	Het
Prr23a2	C	A	9: 98,856,864	H92N	probably damaging	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Rdx	C	A	9: 52,065,817	A122E	probably damaging	Het
Rspo3	T	G	10: 29,454,257	D236A	unknown	Het
Sdk2	A	T	11: 113,832,258	D1302E	probably damaging	Het
Sipa1	A	T	19: 5,660,354	D209E	probably damaging	Het
Sirpa	T	G	2: 129,627,936		probably benign	Het
Ska1	A	C	18: 74,197,499		probably benign	Het
Slc4a9	T	C	18: 36,535,278		probably benign	Het
Slco1b2	T	C	6: 141,685,446	V602A	probably benign	Het
Slco2a1	T	C	9: 103,082,334	V543A	probably damaging	Het
Sorcs3	A	T	19: 48,693,994	L489F	probably damaging	Het
Sorl1	T	C	9: 42,071,069		probably benign	Het
Spindoc	G	T	19: 7,374,735	N82K	probably benign	Het
Stk17b	C	A	1: 53,757,492	C372F	probably damaging	Het
Tbck	A	G	3: 132,722,291		probably benign	Het
Thoc1	C	T	18: 9,963,267	T127I	probably benign	Het
Togaram2	G	T	17: 71,716,444	R765L	probably damaging	Het
Tprg	A	G	16: 25,317,469	Y70C	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Umodl1	T	C	17: 30,996,351	Y1050H	probably damaging	Het
Vmn1r205	T	A	13: 22,592,416	D172V	probably benign	Het
Vmn1r79	A	T	7: 12,177,063	N291Y	probably damaging	Het
Vmn2r112	T	A	17: 22,614,999	N549K	probably damaging	Het
Vrk3	T	A	7: 44,764,803	L241Q	probably damaging	Het
Zc3h7a	A	G	16: 11,151,880	S386P	probably damaging	Het

Other mutations in Cadps2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Cadps2	APN	6	23496874	missense	possibly damaging	0.84
IGL01105:Cadps2	APN	6	23321700	splice site	probably benign
IGL01317:Cadps2	APN	6	23314173	missense	possibly damaging	0.76
IGL01409:Cadps2	APN	6	23587441	missense	probably damaging	1.00
IGL01477:Cadps2	APN	6	23263673	missense	probably damaging	1.00
IGL01620:Cadps2	APN	6	23587462	missense	probably benign	0.19
IGL01674:Cadps2	APN	6	23355852	missense	probably damaging	1.00
IGL01675:Cadps2	APN	6	23382905	missense	probably damaging	1.00
IGL01895:Cadps2	APN	6	23427275	missense	probably damaging	0.98
IGL02095:Cadps2	APN	6	23427310	missense	probably benign	0.01
IGL02200:Cadps2	APN	6	23385528	missense	probably damaging	1.00
IGL02380:Cadps2	APN	6	23287732	missense	probably benign	0.11
IGL02680:Cadps2	APN	6	23838896	missense	probably damaging	0.99
IGL02814:Cadps2	APN	6	23321707	missense	probably damaging	1.00
IGL02940:Cadps2	APN	6	23496809	missense	probably benign	0.08
IGL03061:Cadps2	APN	6	23287660	splice site	probably null
IGL03233:Cadps2	APN	6	23263601	missense	probably benign	0.10
R0193:Cadps2	UTSW	6	23599440	missense	probably benign	0.00
R0389:Cadps2	UTSW	6	23321782	missense	possibly damaging	0.88
R0571:Cadps2	UTSW	6	23583412	missense	probably damaging	1.00
R0595:Cadps2	UTSW	6	23321704	critical splice donor site	probably null
R0620:Cadps2	UTSW	6	23583396	missense	probably damaging	1.00
R0723:Cadps2	UTSW	6	23287698	missense	probably damaging	0.99
R0836:Cadps2	UTSW	6	23328776	splice site	probably benign
R0942:Cadps2	UTSW	6	23263562	missense	probably damaging	1.00
R1099:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R1120:Cadps2	UTSW	6	23838794	missense	probably damaging	1.00
R1216:Cadps2	UTSW	6	23583473	splice site	probably benign
R1575:Cadps2	UTSW	6	23429218	missense	probably damaging	1.00
R1780:Cadps2	UTSW	6	23320932	critical splice donor site	probably null
R1924:Cadps2	UTSW	6	23688858	missense	probably damaging	0.99
R1944:Cadps2	UTSW	6	23599480	missense	probably damaging	0.99
R1956:Cadps2	UTSW	6	23287686	missense	probably damaging	1.00
R1986:Cadps2	UTSW	6	23323380	missense	probably damaging	1.00
R2045:Cadps2	UTSW	6	23839122	missense	possibly damaging	0.73
R2146:Cadps2	UTSW	6	23838999	intron	probably benign
R2147:Cadps2	UTSW	6	23838999	intron	probably benign
R2148:Cadps2	UTSW	6	23838999	intron	probably benign
R2150:Cadps2	UTSW	6	23838999	intron	probably benign
R2219:Cadps2	UTSW	6	23410832	missense	probably damaging	1.00
R2264:Cadps2	UTSW	6	23323340	missense	probably benign	0.15
R2338:Cadps2	UTSW	6	23838978	splice site	probably benign
R3861:Cadps2	UTSW	6	23355861	missense	probably damaging	1.00
R3898:Cadps2	UTSW	6	23528126	missense	probably damaging	1.00
R3982:Cadps2	UTSW	6	23263531	utr 3 prime	probably benign
R4213:Cadps2	UTSW	6	23599463	missense	probably damaging	1.00
R4384:Cadps2	UTSW	6	23412988	missense	probably benign	0.18
R4432:Cadps2	UTSW	6	23626738	missense	probably damaging	0.99
R4609:Cadps2	UTSW	6	23587579	missense	probably damaging	1.00
R4806:Cadps2	UTSW	6	23688860	missense	probably damaging	0.96
R4977:Cadps2	UTSW	6	23599479	missense	probably damaging	1.00
R5174:Cadps2	UTSW	6	23287743	missense	probably damaging	1.00
R5267:Cadps2	UTSW	6	23626668	missense	possibly damaging	0.79
R5389:Cadps2	UTSW	6	23329104	missense	probably damaging	1.00
R5737:Cadps2	UTSW	6	23328805	missense	probably benign	0.28
R6074:Cadps2	UTSW	6	23626671	missense	probably damaging	1.00
R6254:Cadps2	UTSW	6	23329163	critical splice acceptor site	probably null
R6323:Cadps2	UTSW	6	23263578	missense	probably benign	0.04
R6463:Cadps2	UTSW	6	23323334	nonsense	probably null
R6907:Cadps2	UTSW	6	23599506	missense	probably damaging	1.00
R6940:Cadps2	UTSW	6	23302492	missense	probably damaging	1.00
R6964:Cadps2	UTSW	6	23583459	missense	probably damaging	1.00
R7079:Cadps2	UTSW	6	23323409	missense	probably damaging	1.00
R7139:Cadps2	UTSW	6	23410889	missense	probably damaging	1.00
R7156:Cadps2	UTSW	6	23688956	missense	probably benign	0.02
R7184:Cadps2	UTSW	6	23583429	missense	probably benign	0.18
R7325:Cadps2	UTSW	6	23409935	missense	unknown
R7526:Cadps2	UTSW	6	23496851	missense	probably damaging	1.00
R7546:Cadps2	UTSW	6	23626608	missense	probably benign	0.15
R7772:Cadps2	UTSW	6	23390446	missense	probably benign	0.00
R7870:Cadps2	UTSW	6	23263642	missense	probably benign	0.14
R8040:Cadps2	UTSW	6	23412943	splice site	probably benign
R8048:Cadps2	UTSW	6	23838863	missense	probably benign	0.14
R8082:Cadps2	UTSW	6	23323314	missense	probably damaging	1.00
R8100:Cadps2	UTSW	6	23838809	missense	probably damaging	1.00
R8115:Cadps2	UTSW	6	23328898	missense	probably benign	0.00
R8497:Cadps2	UTSW	6	23355919	missense	probably benign	0.27
R8768:Cadps2	UTSW	6	23382939	missense	probably damaging	1.00
R8783:Cadps2	UTSW	6	23302304	missense	possibly damaging	0.57
R8804:Cadps2	UTSW	6	23496806	missense	probably damaging	1.00
R8832:Cadps2	UTSW	6	23587537	missense	possibly damaging	0.52
R8848:Cadps2	UTSW	6	23344257	missense	probably damaging	1.00
R8854:Cadps2	UTSW	6	23385508	missense	probably damaging	1.00
R8896:Cadps2	UTSW	6	23410877	missense	probably damaging	1.00
R8910:Cadps2	UTSW	6	23344224	missense	probably benign	0.11
R8921:Cadps2	UTSW	6	23302301	missense	probably benign	0.00
R9228:Cadps2	UTSW	6	23688928	missense	probably benign	0.00
R9297:Cadps2	UTSW	6	23496888	missense	probably benign
R9318:Cadps2	UTSW	6	23496888	missense	probably benign
R9348:Cadps2	UTSW	6	23344263	missense	probably benign	0.20
R9447:Cadps2	UTSW	6	23323298	missense	probably damaging	0.96
R9484:Cadps2	UTSW	6	23626647	missense	probably benign	0.02
R9492:Cadps2	UTSW	6	23427239	missense	probably benign
R9630:Cadps2	UTSW	6	23587572	missense	probably benign	0.08
R9729:Cadps2	UTSW	6	23382983	missense	probably benign	0.28
Z1176:Cadps2	UTSW	6	23321801	missense	probably benign	0.24
Z1177:Cadps2	UTSW	6	23385478	missense	possibly damaging	0.88
Z1177:Cadps2	UTSW	6	23626695	missense	probably damaging	1.00
Z1177:Cadps2	UTSW	6	23838818	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCTTACCATTTTGCTCAGCCAA -3'
(R):5'- GTGAAACGTGCTTGAACCATTTTCTTCT -3'

Sequencing Primer
(F):5'- TGGATGCAAACTCTGAGTCTTC -3'
(R):5'- GTCTAACCTTTATTTGAGATGCCAGC -3'

Posted On

2013-10-16