Incidental Mutation 'R0831:Rdx'
ID 77551
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
MMRRC Submission 039010-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0831 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 51958450-52000038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 51977117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 122 (A122E)
Ref Sequence ENSEMBL: ENSMUSP00000128249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
AlphaFold P26043
PDB Structure CRYSTAL STRUCTURE OF THE RADIXIN FERM DOMAIN COMPLEXED WITH INOSITOL-(1,4,5)-TRIPHOSPHATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RADIXIN FERM DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the radxin FERM domain complexed with the ICAM-2 cytoplasmic peptide [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NHERF-1 C-terminal tail peptide [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NHERF-2 C-terminal tail peptide [X-RAY DIFFRACTION]
Crystal structure of the dimerized radixin FERM domain [X-RAY DIFFRACTION]
Crystal Structure Analysis of the radixin FERM domain complexed with adhesion molecule CD43 [X-RAY DIFFRACTION]
Crystal Structure Analysis of the radixin FERM domain complexed with adhesion molecule PSGL-1 [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NEP cytoplasmic tail [X-RAY DIFFRACTION]
Crystal structure of the mouse radxin FERM domain complexed with the mouse CD44 cytoplasmic peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000000590
AA Change: A122E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: A122E

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061352
AA Change: A122E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: A122E

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163153
AA Change: A122E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: A122E

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Meta Mutation Damage Score 0.8688 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik C T 7: 12,284,523 (GRCm39) probably benign Het
3425401B19Rik T C 14: 32,384,228 (GRCm39) N579S probably benign Het
Adck1 G T 12: 88,335,118 (GRCm39) M1I probably null Het
Adgra3 A T 5: 50,128,144 (GRCm39) I779N probably damaging Het
Adgrf2 A G 17: 43,021,334 (GRCm39) S497P probably damaging Het
Afg3l2 A C 18: 67,554,297 (GRCm39) F468L probably damaging Het
Alms1 T A 6: 85,605,502 (GRCm39) I2384N probably benign Het
Ankrd13b A T 11: 77,363,585 (GRCm39) S244R probably damaging Het
Aox1 T A 1: 58,378,842 (GRCm39) H1030Q probably benign Het
Ap1b1 A G 11: 4,973,092 (GRCm39) probably benign Het
Atxn2l A G 7: 126,098,332 (GRCm39) S187P probably damaging Het
B4galt4 G T 16: 38,588,341 (GRCm39) E57D probably benign Het
Cad T C 5: 31,224,944 (GRCm39) V949A probably damaging Het
Cadps2 C T 6: 23,321,739 (GRCm39) S1051N possibly damaging Het
Ccdc66 C T 14: 27,219,313 (GRCm39) V148I probably benign Het
Ccser1 C T 6: 61,400,045 (GRCm39) P55S probably damaging Het
Cds2 T C 2: 132,127,887 (GRCm39) probably null Het
Cep95 A G 11: 106,705,530 (GRCm39) D548G probably benign Het
Chil3 A G 3: 106,057,063 (GRCm39) Y294H probably benign Het
Chmp5 A G 4: 40,949,500 (GRCm39) D39G probably damaging Het
Chrd T A 16: 20,560,059 (GRCm39) F887I probably damaging Het
Col24a1 G T 3: 145,034,520 (GRCm39) G580V probably damaging Het
Col6a2 A T 10: 76,439,939 (GRCm39) N655K probably damaging Het
Ctsf A T 19: 4,909,868 (GRCm39) Y416F possibly damaging Het
Dennd5a A C 7: 109,533,961 (GRCm39) V77G probably damaging Het
Dna2 A T 10: 62,795,108 (GRCm39) K460* probably null Het
Dnah17 A T 11: 117,951,097 (GRCm39) M2842K probably damaging Het
Dnajc13 C A 9: 104,049,811 (GRCm39) G1765V probably damaging Het
Donson A C 16: 91,480,651 (GRCm39) C243W probably damaging Het
Dpp8 A T 9: 64,985,961 (GRCm39) N817I possibly damaging Het
Eef1d G A 15: 75,768,655 (GRCm39) probably benign Het
Esf1 T A 2: 140,010,279 (GRCm39) D19V probably damaging Het
Gm21738 T A 14: 19,415,957 (GRCm38) Y194F probably benign Het
Gm21738 T C 14: 19,415,963 (GRCm38) K192R probably benign Het
Gm9867 C A 4: 140,049,799 (GRCm39) A128S unknown Het
Igsf23 G T 7: 19,675,662 (GRCm39) probably benign Het
Inhca T C 9: 103,146,978 (GRCm39) H292R possibly damaging Het
Kdm7a C A 6: 39,143,699 (GRCm39) probably benign Het
Kif14 G A 1: 136,453,609 (GRCm39) probably benign Het
Mroh7 T C 4: 106,537,990 (GRCm39) N1229D possibly damaging Het
Mrps11 C A 7: 78,441,611 (GRCm39) probably benign Het
Mtmr2 T A 9: 13,707,409 (GRCm39) D248E probably damaging Het
Myrfl C A 10: 116,619,114 (GRCm39) S748I probably benign Het
Nop14 T C 5: 34,807,864 (GRCm39) E366G possibly damaging Het
Or13c3 T G 4: 52,855,764 (GRCm39) I250L possibly damaging Het
Or2w25 C T 11: 59,504,480 (GRCm39) T230I possibly damaging Het
Or52z13 A G 7: 103,247,338 (GRCm39) I272V probably benign Het
Or7e177 T A 9: 20,211,861 (GRCm39) C123S probably benign Het
Or8g2b C T 9: 39,751,579 (GRCm39) P283L probably damaging Het
Phykpl G T 11: 51,476,366 (GRCm39) E29* probably null Het
Plppr4 A G 3: 117,125,295 (GRCm39) probably null Het
Prmt2 A C 10: 76,043,641 (GRCm39) probably benign Het
Prodh2 T A 7: 30,193,649 (GRCm39) Y114* probably null Het
Prr23a2 C A 9: 98,738,917 (GRCm39) H92N probably damaging Het
Rasl10b G A 11: 83,308,665 (GRCm39) probably null Het
Rspo3 T G 10: 29,330,253 (GRCm39) D236A unknown Het
Sdk2 A T 11: 113,723,084 (GRCm39) D1302E probably damaging Het
Sipa1 A T 19: 5,710,382 (GRCm39) D209E probably damaging Het
Sirpa T G 2: 129,469,856 (GRCm39) probably benign Het
Ska1 A C 18: 74,330,570 (GRCm39) probably benign Het
Slc4a9 T C 18: 36,668,331 (GRCm39) probably benign Het
Slco1b2 T C 6: 141,631,172 (GRCm39) V602A probably benign Het
Slco2a1 T C 9: 102,959,533 (GRCm39) V543A probably damaging Het
Sorcs3 A T 19: 48,682,433 (GRCm39) L489F probably damaging Het
Sorl1 T C 9: 41,982,365 (GRCm39) probably benign Het
Sp140l1 C G 1: 85,077,226 (GRCm39) K113N probably benign Het
Spindoc G T 19: 7,352,100 (GRCm39) N82K probably benign Het
Stk17b C A 1: 53,796,651 (GRCm39) C372F probably damaging Het
Tbck A G 3: 132,428,052 (GRCm39) probably benign Het
Thoc1 C T 18: 9,963,267 (GRCm39) T127I probably benign Het
Togaram2 G T 17: 72,023,439 (GRCm39) R765L probably damaging Het
Tprg1 A G 16: 25,136,219 (GRCm39) Y70C probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Umodl1 T C 17: 31,215,325 (GRCm39) Y1050H probably damaging Het
Vmn1r205 T A 13: 22,776,586 (GRCm39) D172V probably benign Het
Vmn1r79 A T 7: 11,910,990 (GRCm39) N291Y probably damaging Het
Vmn2r112 T A 17: 22,833,980 (GRCm39) N549K probably damaging Het
Vrk3 T A 7: 44,414,227 (GRCm39) L241Q probably damaging Het
Zc3h7a A G 16: 10,969,744 (GRCm39) S386P probably damaging Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 51,997,646 (GRCm39) missense probably damaging 1.00
IGL02088:Rdx APN 9 51,972,183 (GRCm39) utr 5 prime probably benign
IGL02522:Rdx APN 9 51,979,504 (GRCm39) missense possibly damaging 0.92
R0731:Rdx UTSW 9 51,979,518 (GRCm39) missense probably benign 0.05
R0748:Rdx UTSW 9 51,976,160 (GRCm39) missense possibly damaging 0.87
R1605:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R1688:Rdx UTSW 9 51,972,211 (GRCm39) splice site probably benign
R2127:Rdx UTSW 9 51,981,032 (GRCm39) missense possibly damaging 0.49
R2363:Rdx UTSW 9 51,980,173 (GRCm39) missense probably damaging 1.00
R2899:Rdx UTSW 9 51,980,211 (GRCm39) splice site probably benign
R4184:Rdx UTSW 9 51,978,680 (GRCm39) missense probably damaging 1.00
R4569:Rdx UTSW 9 51,980,141 (GRCm39) missense probably benign 0.07
R4607:Rdx UTSW 9 51,980,137 (GRCm39) missense probably damaging 0.99
R4760:Rdx UTSW 9 51,977,174 (GRCm39) missense probably benign 0.02
R4820:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R4966:Rdx UTSW 9 51,986,309 (GRCm39) missense probably benign 0.00
R6707:Rdx UTSW 9 51,974,954 (GRCm39) missense probably damaging 1.00
R7136:Rdx UTSW 9 51,997,745 (GRCm39) missense probably damaging 1.00
R7308:Rdx UTSW 9 51,980,170 (GRCm39) missense probably damaging 0.98
R7597:Rdx UTSW 9 51,972,196 (GRCm39) missense possibly damaging 0.84
R7835:Rdx UTSW 9 51,977,088 (GRCm39) missense probably damaging 0.98
R7923:Rdx UTSW 9 51,977,201 (GRCm39) missense possibly damaging 0.93
R8055:Rdx UTSW 9 51,997,724 (GRCm39) missense probably damaging 1.00
R8057:Rdx UTSW 9 51,976,946 (GRCm39) missense probably damaging 1.00
R8889:Rdx UTSW 9 51,997,753 (GRCm39) missense probably damaging 1.00
R8983:Rdx UTSW 9 51,974,905 (GRCm39) missense probably damaging 1.00
R9128:Rdx UTSW 9 51,976,179 (GRCm39) nonsense probably null
R9226:Rdx UTSW 9 51,992,468 (GRCm39) missense probably benign 0.01
R9377:Rdx UTSW 9 51,980,168 (GRCm39) missense possibly damaging 0.83
R9469:Rdx UTSW 9 51,977,069 (GRCm39) missense probably damaging 1.00
R9534:Rdx UTSW 9 51,984,482 (GRCm39) nonsense probably null
R9746:Rdx UTSW 9 51,974,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCAGCTCCTTTAGCACCTGTG -3'
(R):5'- GCATGTGTTCCACTCTTTACAAACAGC -3'

Sequencing Primer
(F):5'- CTATTCTAGGTAACACAGCAAGATG -3'
(R):5'- TTCATAGCCTTCCCTAAAGAGC -3'
Posted On 2013-10-16