Incidental Mutation 'R0831:Dnajc13'
ID77556
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R0831 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104172612 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1765 (G1765V)
Ref Sequence ENSEMBL: ENSMUSP00000035170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect probably damaging
Transcript: ENSMUST00000035170
AA Change: G1765V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: G1765V

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185927
Predicted Effect probably damaging
Transcript: ENSMUST00000186788
AA Change: G1770V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: G1770V

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188425
Meta Mutation Damage Score 0.1661 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCACCCTGAATGACAGTGTCC -3'
(R):5'- TGCTATTTACGGCTTAACACCCTGC -3'

Sequencing Primer
(F):5'- ATGACAGTGTCCAGCATTTGC -3'
(R):5'- TGCACAGCTTCCAGATAGACG -3'
Posted On2013-10-16