Incidental Mutation 'R0831:Col6a2'
ID77560
Institutional Source Beutler Lab
Gene Symbol Col6a2
Ensembl Gene ENSMUSG00000020241
Gene Namecollagen, type VI, alpha 2
SynonymsCol6a-2
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0831 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76595762-76623630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76604105 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 655 (N655K)
Ref Sequence ENSEMBL: ENSMUSP00000001181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001181] [ENSMUST00000105413]
Predicted Effect probably damaging
Transcript: ENSMUST00000001181
AA Change: N655K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001181
Gene: ENSMUSG00000020241
AA Change: N655K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 329 3.3e-11 PFAM
Pfam:Collagen 317 383 6.2e-10 PFAM
Pfam:Collagen 366 430 2.2e-8 PFAM
Pfam:Collagen 424 483 1.7e-9 PFAM
low complexity region 502 517 N/A INTRINSIC
Pfam:Collagen 546 605 1.1e-9 PFAM
VWA 628 816 7.51e-36 SMART
VWA 846 1029 3.97e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105413
AA Change: N655K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101053
Gene: ENSMUSG00000020241
AA Change: N655K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 59 246 9.55e-29 SMART
Pfam:Collagen 269 330 5.2e-12 PFAM
Pfam:Collagen 316 384 6.1e-10 PFAM
Pfam:Collagen 364 431 1.4e-8 PFAM
Pfam:Collagen 424 483 5.3e-10 PFAM
Pfam:Collagen 475 542 3.3e-9 PFAM
Pfam:Collagen 531 605 7.4e-8 PFAM
VWA 628 816 7.51e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137365
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The product of this gene contains several domains similar to von Willebrand Factor type A domains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in this gene are associated with Bethlem myopathy and Ullrich scleroatonic muscular dystrophy. Three transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Col6a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Col6a2 APN 10 76614534 missense probably damaging 0.96
IGL01995:Col6a2 APN 10 76604842 splice site probably benign
IGL02005:Col6a2 APN 10 76610173 missense probably damaging 1.00
IGL02793:Col6a2 APN 10 76596310 missense possibly damaging 0.96
IGL03144:Col6a2 APN 10 76614425 missense probably benign
piddling UTSW 10 76608106 critical splice donor site probably null
R0137:Col6a2 UTSW 10 76596425 missense probably damaging 1.00
R0371:Col6a2 UTSW 10 76614473 missense probably benign 0.25
R0423:Col6a2 UTSW 10 76614917 missense possibly damaging 0.85
R0554:Col6a2 UTSW 10 76611161 critical splice donor site probably null
R0781:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R1110:Col6a2 UTSW 10 76607740 missense probably benign 0.00
R1499:Col6a2 UTSW 10 76603710 missense probably damaging 1.00
R1502:Col6a2 UTSW 10 76614678 missense probably benign 0.00
R1854:Col6a2 UTSW 10 76614812 missense probably damaging 0.98
R1878:Col6a2 UTSW 10 76614788 missense probably benign 0.00
R3410:Col6a2 UTSW 10 76603359 missense probably benign 0.17
R4110:Col6a2 UTSW 10 76606169 splice site probably null
R4242:Col6a2 UTSW 10 76608106 critical splice donor site probably null
R5562:Col6a2 UTSW 10 76599675 nonsense probably null
R5603:Col6a2 UTSW 10 76596769 missense probably damaging 1.00
R5641:Col6a2 UTSW 10 76613278 missense probably damaging 1.00
R5681:Col6a2 UTSW 10 76609251 splice site probably null
R5707:Col6a2 UTSW 10 76611031 missense possibly damaging 0.95
R5735:Col6a2 UTSW 10 76599893 missense probably benign 0.32
R5789:Col6a2 UTSW 10 76604389 missense probably damaging 1.00
R6134:Col6a2 UTSW 10 76607144 missense probably damaging 0.97
R6156:Col6a2 UTSW 10 76604170 missense possibly damaging 0.92
R6208:Col6a2 UTSW 10 76615057 missense possibly damaging 0.88
R6296:Col6a2 UTSW 10 76611049 missense probably damaging 1.00
R6328:Col6a2 UTSW 10 76614378 missense possibly damaging 0.67
R6329:Col6a2 UTSW 10 76599828 missense probably benign 0.01
R6722:Col6a2 UTSW 10 76614558 missense probably damaging 0.98
R7012:Col6a2 UTSW 10 76614677 missense possibly damaging 0.95
R7091:Col6a2 UTSW 10 76615091 missense unknown
R7422:Col6a2 UTSW 10 76603336 nonsense probably null
R7655:Col6a2 UTSW 10 76607756 missense probably benign 0.00
R7656:Col6a2 UTSW 10 76607756 missense probably benign 0.00
R7802:Col6a2 UTSW 10 76603798 missense probably damaging 1.00
RF020:Col6a2 UTSW 10 76606209 critical splice acceptor site probably null
Z1177:Col6a2 UTSW 10 76596350 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGATCAGCATGAACAGTGTCCACC -3'
(R):5'- TGAGTTGGCCCAACACATCAGG -3'

Sequencing Primer
(F):5'- ACAGTGTCCACCATGACTGG -3'
(R):5'- GATCCCTCACAGTCTCTCCAG -3'
Posted On2013-10-16