Incidental Mutation 'R0831:Sdk2'
ID77568
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Namesidekick cell adhesion molecule 2
Synonyms5330435L01Rik, 4632412F08Rik
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0831 (G1)
Quality Score212
Status Validated
Chromosome11
Chromosomal Location113776374-114067046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113832258 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1302 (D1302E)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
Predicted Effect probably damaging
Transcript: ENSMUST00000041627
AA Change: D1302E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: D1302E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Meta Mutation Damage Score 0.1339 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
Curtailed UTSW 11 113851800 missense probably damaging 1.00
Trimmed UTSW 11 113856696 nonsense probably null
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
BB008:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113827086 missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113868083 splice site probably null
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113873201 missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113859938 missense probably benign 0.18
R8052:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113827089 missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113851713 missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113872857 missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113838716 missense probably benign
R8715:Sdk2 UTSW 11 113780902 missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113873152 nonsense probably null
RF002:Sdk2 UTSW 11 113885252 missense probably benign 0.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113839322 missense probably benign 0.41
Z1176:Sdk2 UTSW 11 113851836 missense probably damaging 0.97
Z1177:Sdk2 UTSW 11 113838659 missense probably damaging 0.99
Z1177:Sdk2 UTSW 11 113839320 missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113859956 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACGAGTCAGACATCCAACTGTCC -3'
(R):5'- TGAGTCTCCCCAAGTGTCTTAGACC -3'

Sequencing Primer
(F):5'- AGACATCCAACTGTCCTTACCTG -3'
(R):5'- TTCCAAGAACCCTTTGGGGC -3'
Posted On2013-10-16