Mutagenetix > Incidental Mutation

Incidental Mutation 'R0831:Sdk2'

77568

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

039010-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R0831 (G1)

Quality Score

212

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113832258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1302 (D1302E)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627]

AlphaFold

Q6V4S5

Predicted Effect

probably damaging
Transcript: ENSMUST00000041627
AA Change: D1302E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: D1302E

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Meta Mutation Damage Score

0.1339

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.0%

Validation Efficiency

95% (82/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,269,779	H292R	possibly damaging	Het
2900092C05Rik	C	T	7: 12,550,596		probably benign	Het
3425401B19Rik	T	C	14: 32,662,271	N579S	probably benign	Het
A530032D15Rik	C	G	1: 85,099,505	K113N	probably benign	Het
Adck1	G	T	12: 88,368,348	M1I	probably null	Het
Adgra3	A	T	5: 49,970,802	I779N	probably damaging	Het
Adgrf2	A	G	17: 42,710,443	S497P	probably damaging	Het
Afg3l2	A	C	18: 67,421,227	F468L	probably damaging	Het
Alms1	T	A	6: 85,628,520	I2384N	probably benign	Het
Ankrd13b	A	T	11: 77,472,759	S244R	probably damaging	Het
Aox2	T	A	1: 58,339,683	H1030Q	probably benign	Het
Ap1b1	A	G	11: 5,023,092		probably benign	Het
Atxn2l	A	G	7: 126,499,160	S187P	probably damaging	Het
B4galt4	G	T	16: 38,767,979	E57D	probably benign	Het
Cad	T	C	5: 31,067,600	V949A	probably damaging	Het
Cadps2	C	T	6: 23,321,740	S1051N	possibly damaging	Het
Ccdc66	C	T	14: 27,497,356	V148I	probably benign	Het
Ccser1	C	T	6: 61,423,061	P55S	probably damaging	Het
Cds2	T	C	2: 132,285,967		probably null	Het
Cep95	A	G	11: 106,814,704	D548G	probably benign	Het
Chil3	A	G	3: 106,149,747	Y294H	probably benign	Het
Chmp5	A	G	4: 40,949,500	D39G	probably damaging	Het
Chrd	T	A	16: 20,741,309	F887I	probably damaging	Het
Col24a1	G	T	3: 145,328,759	G580V	probably damaging	Het
Col6a2	A	T	10: 76,604,105	N655K	probably damaging	Het
Ctsf	A	T	19: 4,859,840	Y416F	possibly damaging	Het
Dennd5a	A	C	7: 109,934,754	V77G	probably damaging	Het
Dna2	A	T	10: 62,959,329	K460*	probably null	Het
Dnah17	A	T	11: 118,060,271	M2842K	probably damaging	Het
Dnajc13	C	A	9: 104,172,612	G1765V	probably damaging	Het
Donson	A	C	16: 91,683,763	C243W	probably damaging	Het
Dpp8	A	T	9: 65,078,679	N817I	possibly damaging	Het
Eef1d	G	A	15: 75,896,806		probably benign	Het
Esf1	T	A	2: 140,168,359	D19V	probably damaging	Het
Gm21738	T	A	14: 19,415,957	Y194F	probably benign	Het
Gm21738	T	C	14: 19,415,963	K192R	probably benign	Het
Gm9867	C	A	4: 140,322,488	A128S	unknown	Het
Igsf23	G	T	7: 19,941,737		probably benign	Het
Kdm7a	C	A	6: 39,166,765		probably benign	Het
Kif14	G	A	1: 136,525,871		probably benign	Het
Mroh7	T	C	4: 106,680,793	N1229D	possibly damaging	Het
Mrps11	C	A	7: 78,791,863		probably benign	Het
Mtmr2	T	A	9: 13,796,113	D248E	probably damaging	Het
Myrfl	C	A	10: 116,783,209	S748I	probably benign	Het
Nop14	T	C	5: 34,650,520	E366G	possibly damaging	Het
Olfr225	C	T	11: 59,613,654	T230I	possibly damaging	Het
Olfr273	T	G	4: 52,855,764	I250L	possibly damaging	Het
Olfr618	A	G	7: 103,598,131	I272V	probably benign	Het
Olfr873	T	A	9: 20,300,565	C123S	probably benign	Het
Olfr971	C	T	9: 39,840,283	P283L	probably damaging	Het
Phykpl	G	T	11: 51,585,539	E29*	probably null	Het
Plppr4	A	G	3: 117,331,646		probably null	Het
Prmt2	A	C	10: 76,207,807		probably benign	Het
Prodh2	T	A	7: 30,494,224	Y114*	probably null	Het
Prr23a2	C	A	9: 98,856,864	H92N	probably damaging	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Rdx	C	A	9: 52,065,817	A122E	probably damaging	Het
Rspo3	T	G	10: 29,454,257	D236A	unknown	Het
Sipa1	A	T	19: 5,660,354	D209E	probably damaging	Het
Sirpa	T	G	2: 129,627,936		probably benign	Het
Ska1	A	C	18: 74,197,499		probably benign	Het
Slc4a9	T	C	18: 36,535,278		probably benign	Het
Slco1b2	T	C	6: 141,685,446	V602A	probably benign	Het
Slco2a1	T	C	9: 103,082,334	V543A	probably damaging	Het
Sorcs3	A	T	19: 48,693,994	L489F	probably damaging	Het
Sorl1	T	C	9: 42,071,069		probably benign	Het
Spindoc	G	T	19: 7,374,735	N82K	probably benign	Het
Stk17b	C	A	1: 53,757,492	C372F	probably damaging	Het
Tbck	A	G	3: 132,722,291		probably benign	Het
Thoc1	C	T	18: 9,963,267	T127I	probably benign	Het
Togaram2	G	T	17: 71,716,444	R765L	probably damaging	Het
Tprg	A	G	16: 25,317,469	Y70C	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Umodl1	T	C	17: 30,996,351	Y1050H	probably damaging	Het
Vmn1r205	T	A	13: 22,592,416	D172V	probably benign	Het
Vmn1r79	A	T	7: 12,177,063	N291Y	probably damaging	Het
Vmn2r112	T	A	17: 22,614,999	N549K	probably damaging	Het
Vrk3	T	A	7: 44,764,803	L241Q	probably damaging	Het
Zc3h7a	A	G	16: 11,151,880	S386P	probably damaging	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7552:Sdk2	UTSW	11	113873213	missense	possibly damaging	0.63
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACGAGTCAGACATCCAACTGTCC -3'
(R):5'- TGAGTCTCCCCAAGTGTCTTAGACC -3'

Sequencing Primer
(F):5'- AGACATCCAACTGTCCTTACCTG -3'
(R):5'- TTCCAAGAACCCTTTGGGGC -3'

Posted On

2013-10-16