Incidental Mutation 'R0831:Zc3h7a'
ID77578
Institutional Source Beutler Lab
Gene Symbol Zc3h7a
Ensembl Gene ENSMUSG00000037965
Gene Namezinc finger CCCH type containing 7 A
SynonymsZc3h7, A430104C18Rik
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0831 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location11136592-11176393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11151880 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 386 (S386P)
Ref Sequence ENSEMBL: ENSMUSP00000114246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000128083] [ENSMUST00000130355] [ENSMUST00000138185] [ENSMUST00000140755]
Predicted Effect probably benign
Transcript: ENSMUST00000037633
AA Change: S386P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965
AA Change: S386P

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128083
AA Change: S386P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965
AA Change: S386P

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 2.7e-8 PFAM
Blast:TPR 124 156 4e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130355
SMART Domains Protein: ENSMUSP00000120931
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 4.4e-9 PFAM
Blast:TPR 124 156 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138185
AA Change: S386P

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965
AA Change: S386P

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 3.9e-8 PFAM
Blast:TPR 124 156 6e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 4e-10 BLAST
Blast:ZnF_C3H1 628 654 5e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139391
Predicted Effect probably benign
Transcript: ENSMUST00000140755
SMART Domains Protein: ENSMUSP00000120720
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 1e-7 PFAM
Blast:TPR 124 156 5e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140775
Predicted Effect probably benign
Transcript: ENSMUST00000140898
SMART Domains Protein: ENSMUSP00000118771
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:ZnF_C3H1 45 71 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155343
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Other mutations in Zc3h7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Zc3h7a APN 16 11137338 missense probably damaging 0.98
IGL00908:Zc3h7a APN 16 11145242 missense probably damaging 0.99
IGL01087:Zc3h7a APN 16 11153182 missense probably benign 0.28
IGL01285:Zc3h7a APN 16 11139115 missense probably damaging 1.00
IGL01453:Zc3h7a APN 16 11149378 missense probably benign 0.00
IGL01639:Zc3h7a APN 16 11141708 missense possibly damaging 0.75
IGL01716:Zc3h7a APN 16 11145716 missense probably damaging 1.00
IGL02059:Zc3h7a APN 16 11160998 unclassified probably benign
IGL02170:Zc3h7a APN 16 11146395 missense probably benign
IGL02256:Zc3h7a APN 16 11147276 missense probably benign 0.04
IGL02904:Zc3h7a APN 16 11150666 missense probably damaging 1.00
IGL02941:Zc3h7a APN 16 11158594 critical splice acceptor site probably null
IGL03198:Zc3h7a APN 16 11162664 nonsense probably null
IGL03201:Zc3h7a APN 16 11156302 critical splice acceptor site probably null
IGL03302:Zc3h7a APN 16 11141710 missense probably damaging 1.00
Clement UTSW 16 11164602 nonsense probably null
R0062:Zc3h7a UTSW 16 11139147 missense probably damaging 1.00
R0255:Zc3h7a UTSW 16 11140737 missense probably damaging 1.00
R0376:Zc3h7a UTSW 16 11156202 missense probably benign 0.00
R0545:Zc3h7a UTSW 16 11152333 unclassified probably benign
R0666:Zc3h7a UTSW 16 11156303 unclassified probably benign
R1127:Zc3h7a UTSW 16 11139075 missense probably damaging 1.00
R1296:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1472:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1499:Zc3h7a UTSW 16 11162656 missense probably damaging 1.00
R1747:Zc3h7a UTSW 16 11145253 missense possibly damaging 0.67
R1786:Zc3h7a UTSW 16 11150605 nonsense probably null
R1840:Zc3h7a UTSW 16 11161026 missense probably damaging 1.00
R1866:Zc3h7a UTSW 16 11147304 missense possibly damaging 0.81
R2055:Zc3h7a UTSW 16 11137476 missense probably benign 0.00
R2131:Zc3h7a UTSW 16 11150605 nonsense probably null
R2281:Zc3h7a UTSW 16 11158594 unclassified probably benign
R2399:Zc3h7a UTSW 16 11147401 missense probably damaging 1.00
R2979:Zc3h7a UTSW 16 11158973 missense probably damaging 1.00
R3915:Zc3h7a UTSW 16 11156210 missense possibly damaging 0.92
R4078:Zc3h7a UTSW 16 11151147 missense probably benign 0.05
R4095:Zc3h7a UTSW 16 11145235 missense probably damaging 1.00
R4208:Zc3h7a UTSW 16 11164644 missense possibly damaging 0.60
R4444:Zc3h7a UTSW 16 11150593 critical splice donor site probably null
R4739:Zc3h7a UTSW 16 11141709 missense probably damaging 1.00
R5059:Zc3h7a UTSW 16 11161121 frame shift probably null
R5545:Zc3h7a UTSW 16 11148451 missense possibly damaging 0.89
R5815:Zc3h7a UTSW 16 11156186 missense probably damaging 0.98
R5915:Zc3h7a UTSW 16 11164602 nonsense probably null
R5993:Zc3h7a UTSW 16 11150662 missense probably damaging 1.00
R6183:Zc3h7a UTSW 16 11147370 missense possibly damaging 0.81
R6459:Zc3h7a UTSW 16 11153161 missense probably damaging 1.00
R6513:Zc3h7a UTSW 16 11158765 critical splice acceptor site probably null
R6700:Zc3h7a UTSW 16 11158967 missense possibly damaging 0.59
R6904:Zc3h7a UTSW 16 11145671 missense probably damaging 1.00
R6964:Zc3h7a UTSW 16 11149224 missense probably benign 0.00
R7354:Zc3h7a UTSW 16 11148514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTGACAGATCCAGTCACACAC -3'
(R):5'- TTGAAAACCGTGGGCTCCAGGATG -3'

Sequencing Primer
(F):5'- GTCACACACTCAAAACATTTATACTG -3'
(R):5'- AGCCCTCTTTTGTCAGTAGTAAG -3'
Posted On2013-10-16