Mutagenetix > Incidental Mutation

Incidental Mutation 'R0831:Umodl1'

77584

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

039010-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0831 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30996351 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1050 (Y1050H)

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably damaging
Transcript: ENSMUST00000066554
AA Change: Y1050H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: Y1050H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000066981
AA Change: Y935H

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: Y935H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114555
AA Change: Y1050H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: Y1050H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Meta Mutation Damage Score

0.2280

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.0%

Validation Efficiency

95% (82/86)

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,269,779	H292R	possibly damaging	Het
2900092C05Rik	C	T	7: 12,550,596		probably benign	Het
3425401B19Rik	T	C	14: 32,662,271	N579S	probably benign	Het
A530032D15Rik	C	G	1: 85,099,505	K113N	probably benign	Het
Adck1	G	T	12: 88,368,348	M1I	probably null	Het
Adgra3	A	T	5: 49,970,802	I779N	probably damaging	Het
Adgrf2	A	G	17: 42,710,443	S497P	probably damaging	Het
Afg3l2	A	C	18: 67,421,227	F468L	probably damaging	Het
Alms1	T	A	6: 85,628,520	I2384N	probably benign	Het
Ankrd13b	A	T	11: 77,472,759	S244R	probably damaging	Het
Aox2	T	A	1: 58,339,683	H1030Q	probably benign	Het
Ap1b1	A	G	11: 5,023,092		probably benign	Het
Atxn2l	A	G	7: 126,499,160	S187P	probably damaging	Het
B4galt4	G	T	16: 38,767,979	E57D	probably benign	Het
Cad	T	C	5: 31,067,600	V949A	probably damaging	Het
Cadps2	C	T	6: 23,321,740	S1051N	possibly damaging	Het
Ccdc66	C	T	14: 27,497,356	V148I	probably benign	Het
Ccser1	C	T	6: 61,423,061	P55S	probably damaging	Het
Cds2	T	C	2: 132,285,967		probably null	Het
Cep95	A	G	11: 106,814,704	D548G	probably benign	Het
Chil3	A	G	3: 106,149,747	Y294H	probably benign	Het
Chmp5	A	G	4: 40,949,500	D39G	probably damaging	Het
Chrd	T	A	16: 20,741,309	F887I	probably damaging	Het
Col24a1	G	T	3: 145,328,759	G580V	probably damaging	Het
Col6a2	A	T	10: 76,604,105	N655K	probably damaging	Het
Ctsf	A	T	19: 4,859,840	Y416F	possibly damaging	Het
Dennd5a	A	C	7: 109,934,754	V77G	probably damaging	Het
Dna2	A	T	10: 62,959,329	K460*	probably null	Het
Dnah17	A	T	11: 118,060,271	M2842K	probably damaging	Het
Dnajc13	C	A	9: 104,172,612	G1765V	probably damaging	Het
Donson	A	C	16: 91,683,763	C243W	probably damaging	Het
Dpp8	A	T	9: 65,078,679	N817I	possibly damaging	Het
Eef1d	G	A	15: 75,896,806		probably benign	Het
Esf1	T	A	2: 140,168,359	D19V	probably damaging	Het
Gm21738	T	A	14: 19,415,957	Y194F	probably benign	Het
Gm21738	T	C	14: 19,415,963	K192R	probably benign	Het
Gm9867	C	A	4: 140,322,488	A128S	unknown	Het
Igsf23	G	T	7: 19,941,737		probably benign	Het
Kdm7a	C	A	6: 39,166,765		probably benign	Het
Kif14	G	A	1: 136,525,871		probably benign	Het
Mroh7	T	C	4: 106,680,793	N1229D	possibly damaging	Het
Mrps11	C	A	7: 78,791,863		probably benign	Het
Mtmr2	T	A	9: 13,796,113	D248E	probably damaging	Het
Myrfl	C	A	10: 116,783,209	S748I	probably benign	Het
Nop14	T	C	5: 34,650,520	E366G	possibly damaging	Het
Olfr225	C	T	11: 59,613,654	T230I	possibly damaging	Het
Olfr273	T	G	4: 52,855,764	I250L	possibly damaging	Het
Olfr618	A	G	7: 103,598,131	I272V	probably benign	Het
Olfr873	T	A	9: 20,300,565	C123S	probably benign	Het
Olfr971	C	T	9: 39,840,283	P283L	probably damaging	Het
Phykpl	G	T	11: 51,585,539	E29*	probably null	Het
Plppr4	A	G	3: 117,331,646		probably null	Het
Prmt2	A	C	10: 76,207,807		probably benign	Het
Prodh2	T	A	7: 30,494,224	Y114*	probably null	Het
Prr23a2	C	A	9: 98,856,864	H92N	probably damaging	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Rdx	C	A	9: 52,065,817	A122E	probably damaging	Het
Rspo3	T	G	10: 29,454,257	D236A	unknown	Het
Sdk2	A	T	11: 113,832,258	D1302E	probably damaging	Het
Sipa1	A	T	19: 5,660,354	D209E	probably damaging	Het
Sirpa	T	G	2: 129,627,936		probably benign	Het
Ska1	A	C	18: 74,197,499		probably benign	Het
Slc4a9	T	C	18: 36,535,278		probably benign	Het
Slco1b2	T	C	6: 141,685,446	V602A	probably benign	Het
Slco2a1	T	C	9: 103,082,334	V543A	probably damaging	Het
Sorcs3	A	T	19: 48,693,994	L489F	probably damaging	Het
Sorl1	T	C	9: 42,071,069		probably benign	Het
Spindoc	G	T	19: 7,374,735	N82K	probably benign	Het
Stk17b	C	A	1: 53,757,492	C372F	probably damaging	Het
Tbck	A	G	3: 132,722,291		probably benign	Het
Thoc1	C	T	18: 9,963,267	T127I	probably benign	Het
Togaram2	G	T	17: 71,716,444	R765L	probably damaging	Het
Tprg	A	G	16: 25,317,469	Y70C	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn1r205	T	A	13: 22,592,416	D172V	probably benign	Het
Vmn1r79	A	T	7: 12,177,063	N291Y	probably damaging	Het
Vmn2r112	T	A	17: 22,614,999	N549K	probably damaging	Het
Vrk3	T	A	7: 44,764,803	L241Q	probably damaging	Het
Zc3h7a	A	G	16: 11,151,880	S386P	probably damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCCTTTGTCTCCTTGGAACCTG -3'
(R):5'- TGAATAAGAGCCTTCCTGGTCTCCC -3'

Sequencing Primer
(F):5'- TGACCCTTCTGGCAACATGAC -3'
(R):5'- GTCTCCCTACCAGGTGCAAAC -3'

Posted On

2013-10-16