Incidental Mutation 'R0831:Slc4a9'
Institutional Source Beutler Lab
Gene Symbol Slc4a9
Ensembl Gene ENSMUSG00000024485
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 9
SynonymsAE4, D630024F24Rik
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R0831 (G1)
Quality Score212
Status Validated
Chromosomal Location36528157-36541293 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 36535278 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074298] [ENSMUST00000115694]
Predicted Effect probably benign
Transcript: ENSMUST00000074298
SMART Domains Protein: ENSMUSP00000073910
Gene: ENSMUSG00000024485

low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 174 4.6e-19 PFAM
Pfam:Band_3_cyto 161 300 7.1e-45 PFAM
Pfam:HCO3_cotransp 367 788 2.7e-168 PFAM
transmembrane domain 794 816 N/A INTRINSIC
low complexity region 830 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115694
SMART Domains Protein: ENSMUSP00000111358
Gene: ENSMUSG00000024485

low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 170 1.9e-15 PFAM
Pfam:Band_3_cyto 159 300 1e-38 PFAM
Pfam:HCO3_cotransp 349 805 3.1e-174 PFAM
Pfam:HCO3_cotransp 801 837 1.1e-11 PFAM
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 879 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in anion exchange. Expression of this gene is mostly limited to the kidney. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered ion exchange in intestinal epithelia and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Afg3l2 A C 18: 67,421,227 F468L probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Slc4a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Slc4a9 APN 18 36539596 splice site probably benign
IGL01890:Slc4a9 APN 18 36529707 missense possibly damaging 0.63
IGL01995:Slc4a9 APN 18 36539775 missense possibly damaging 0.64
IGL02293:Slc4a9 APN 18 36533215 missense probably benign 0.00
IGL02476:Slc4a9 APN 18 36535445 critical splice donor site probably null
IGL02690:Slc4a9 APN 18 36531987 missense probably damaging 1.00
IGL02726:Slc4a9 APN 18 36539617 missense probably benign 0.24
IGL03003:Slc4a9 APN 18 36536893 missense probably damaging 1.00
IGL03344:Slc4a9 APN 18 36535601 missense probably damaging 1.00
IGL03410:Slc4a9 APN 18 36529687 missense probably benign
R0025:Slc4a9 UTSW 18 36531666 splice site probably benign
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0330:Slc4a9 UTSW 18 36535539 missense probably damaging 1.00
R0457:Slc4a9 UTSW 18 36535418 missense probably damaging 1.00
R0989:Slc4a9 UTSW 18 36536867 nonsense probably null
R1016:Slc4a9 UTSW 18 36531425 missense probably benign 0.12
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1598:Slc4a9 UTSW 18 36528371 nonsense probably null
R1710:Slc4a9 UTSW 18 36532022 missense probably benign
R2041:Slc4a9 UTSW 18 36530793 missense possibly damaging 0.93
R2216:Slc4a9 UTSW 18 36530745 missense probably benign 0.05
R3899:Slc4a9 UTSW 18 36535563 missense probably benign 0.09
R5236:Slc4a9 UTSW 18 36530847 missense probably benign
R5902:Slc4a9 UTSW 18 36529333 splice site probably null
R5902:Slc4a9 UTSW 18 36531507 missense probably damaging 1.00
R5978:Slc4a9 UTSW 18 36535403 missense probably damaging 1.00
R6438:Slc4a9 UTSW 18 36535687 missense probably benign 0.00
R6452:Slc4a9 UTSW 18 36531459 missense probably damaging 1.00
R7238:Slc4a9 UTSW 18 36529720 missense probably benign 0.00
R7329:Slc4a9 UTSW 18 36540821 missense possibly damaging 0.76
R7409:Slc4a9 UTSW 18 36530805 missense probably damaging 0.99
R7649:Slc4a9 UTSW 18 36528377 missense probably benign 0.16
R7694:Slc4a9 UTSW 18 36536849 missense probably damaging 0.99
R7856:Slc4a9 UTSW 18 36528698 missense probably benign 0.04
R7939:Slc4a9 UTSW 18 36528698 missense probably benign 0.04
Z1177:Slc4a9 UTSW 18 36531428 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gaaagagagagagagagacagac -3'
Posted On2013-10-16