Mutagenetix > Incidental Mutations

Incidental Mutation 'R0831:Afg3l2'

77589

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

039010-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0831 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 67421227 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 468 (F468L)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: F468L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: F468L

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.0%

Validation Efficiency

95% (82/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,269,779	H292R	possibly damaging	Het
2900092C05Rik	C	T	7: 12,550,596		probably benign	Het
3425401B19Rik	T	C	14: 32,662,271	N579S	probably benign	Het
A530032D15Rik	C	G	1: 85,099,505	K113N	probably benign	Het
Adck1	G	T	12: 88,368,348	M1I	probably null	Het
Adgra3	A	T	5: 49,970,802	I779N	probably damaging	Het
Adgrf2	A	G	17: 42,710,443	S497P	probably damaging	Het
Alms1	T	A	6: 85,628,520	I2384N	probably benign	Het
Ankrd13b	A	T	11: 77,472,759	S244R	probably damaging	Het
Aox2	T	A	1: 58,339,683	H1030Q	probably benign	Het
Ap1b1	A	G	11: 5,023,092		probably benign	Het
Atxn2l	A	G	7: 126,499,160	S187P	probably damaging	Het
B4galt4	G	T	16: 38,767,979	E57D	probably benign	Het
Cad	T	C	5: 31,067,600	V949A	probably damaging	Het
Cadps2	C	T	6: 23,321,740	S1051N	possibly damaging	Het
Ccdc66	C	T	14: 27,497,356	V148I	probably benign	Het
Ccser1	C	T	6: 61,423,061	P55S	probably damaging	Het
Cds2	T	C	2: 132,285,967		probably null	Het
Cep95	A	G	11: 106,814,704	D548G	probably benign	Het
Chil3	A	G	3: 106,149,747	Y294H	probably benign	Het
Chmp5	A	G	4: 40,949,500	D39G	probably damaging	Het
Chrd	T	A	16: 20,741,309	F887I	probably damaging	Het
Col24a1	G	T	3: 145,328,759	G580V	probably damaging	Het
Col6a2	A	T	10: 76,604,105	N655K	probably damaging	Het
Ctsf	A	T	19: 4,859,840	Y416F	possibly damaging	Het
Dennd5a	A	C	7: 109,934,754	V77G	probably damaging	Het
Dna2	A	T	10: 62,959,329	K460*	probably null	Het
Dnah17	A	T	11: 118,060,271	M2842K	probably damaging	Het
Dnajc13	C	A	9: 104,172,612	G1765V	probably damaging	Het
Donson	A	C	16: 91,683,763	C243W	probably damaging	Het
Dpp8	A	T	9: 65,078,679	N817I	possibly damaging	Het
Eef1d	G	A	15: 75,896,806		probably benign	Het
Esf1	T	A	2: 140,168,359	D19V	probably damaging	Het
Gm21738	T	A	14: 19,415,957	Y194F	probably benign	Het
Gm21738	T	C	14: 19,415,963	K192R	probably benign	Het
Gm9867	C	A	4: 140,322,488	A128S	unknown	Het
Igsf23	G	T	7: 19,941,737		probably benign	Het
Kdm7a	C	A	6: 39,166,765		probably benign	Het
Kif14	G	A	1: 136,525,871		probably benign	Het
Mroh7	T	C	4: 106,680,793	N1229D	possibly damaging	Het
Mrps11	C	A	7: 78,791,863		probably benign	Het
Mtmr2	T	A	9: 13,796,113	D248E	probably damaging	Het
Myrfl	C	A	10: 116,783,209	S748I	probably benign	Het
Nop14	T	C	5: 34,650,520	E366G	possibly damaging	Het
Olfr225	C	T	11: 59,613,654	T230I	possibly damaging	Het
Olfr273	T	G	4: 52,855,764	I250L	possibly damaging	Het
Olfr618	A	G	7: 103,598,131	I272V	probably benign	Het
Olfr873	T	A	9: 20,300,565	C123S	probably benign	Het
Olfr971	C	T	9: 39,840,283	P283L	probably damaging	Het
Phykpl	G	T	11: 51,585,539	E29*	probably null	Het
Plppr4	A	G	3: 117,331,646		probably null	Het
Prmt2	A	C	10: 76,207,807		probably benign	Het
Prodh2	T	A	7: 30,494,224	Y114*	probably null	Het
Prr23a2	C	A	9: 98,856,864	H92N	probably damaging	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Rdx	C	A	9: 52,065,817	A122E	probably damaging	Het
Rspo3	T	G	10: 29,454,257	D236A	unknown	Het
Sdk2	A	T	11: 113,832,258	D1302E	probably damaging	Het
Sipa1	A	T	19: 5,660,354	D209E	probably damaging	Het
Sirpa	T	G	2: 129,627,936		probably benign	Het
Ska1	A	C	18: 74,197,499		probably benign	Het
Slc4a9	T	C	18: 36,535,278		probably benign	Het
Slco1b2	T	C	6: 141,685,446	V602A	probably benign	Het
Slco2a1	T	C	9: 103,082,334	V543A	probably damaging	Het
Sorcs3	A	T	19: 48,693,994	L489F	probably damaging	Het
Sorl1	T	C	9: 42,071,069		probably benign	Het
Spindoc	G	T	19: 7,374,735	N82K	probably benign	Het
Stk17b	C	A	1: 53,757,492	C372F	probably damaging	Het
Tbck	A	G	3: 132,722,291		probably benign	Het
Thoc1	C	T	18: 9,963,267	T127I	probably benign	Het
Togaram2	G	T	17: 71,716,444	R765L	probably damaging	Het
Tprg	A	G	16: 25,317,469	Y70C	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Umodl1	T	C	17: 30,996,351	Y1050H	probably damaging	Het
Vmn1r205	T	A	13: 22,592,416	D172V	probably benign	Het
Vmn1r79	A	T	7: 12,177,063	N291Y	probably damaging	Het
Vmn2r112	T	A	17: 22,614,999	N549K	probably damaging	Het
Vrk3	T	A	7: 44,764,803	L241Q	probably damaging	Het
Zc3h7a	A	G	16: 11,151,880	S386P	probably damaging	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- TGAAAACCCTGGAGTTAAGGACGC -3'
(R):5'- GGCTTTGTGATACCCTTCTACTGGC -3'

Sequencing Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- GGCAGCCAATCTTGTTTTCAG -3'

Posted On

2013-10-16