Incidental Mutation 'R0831:Afg3l2'
ID77589
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene NameAFG3-like AAA ATPase 2
Synonyms2310036I02Rik, Emv66, par
MMRRC Submission 039010-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0831 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location67404767-67449166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 67421227 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 468 (F468L)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: F468L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: F468L

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.0%
Validation Efficiency 95% (82/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,269,779 H292R possibly damaging Het
2900092C05Rik C T 7: 12,550,596 probably benign Het
3425401B19Rik T C 14: 32,662,271 N579S probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Adck1 G T 12: 88,368,348 M1I probably null Het
Adgra3 A T 5: 49,970,802 I779N probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Alms1 T A 6: 85,628,520 I2384N probably benign Het
Ankrd13b A T 11: 77,472,759 S244R probably damaging Het
Aox2 T A 1: 58,339,683 H1030Q probably benign Het
Ap1b1 A G 11: 5,023,092 probably benign Het
Atxn2l A G 7: 126,499,160 S187P probably damaging Het
B4galt4 G T 16: 38,767,979 E57D probably benign Het
Cad T C 5: 31,067,600 V949A probably damaging Het
Cadps2 C T 6: 23,321,740 S1051N possibly damaging Het
Ccdc66 C T 14: 27,497,356 V148I probably benign Het
Ccser1 C T 6: 61,423,061 P55S probably damaging Het
Cds2 T C 2: 132,285,967 probably null Het
Cep95 A G 11: 106,814,704 D548G probably benign Het
Chil3 A G 3: 106,149,747 Y294H probably benign Het
Chmp5 A G 4: 40,949,500 D39G probably damaging Het
Chrd T A 16: 20,741,309 F887I probably damaging Het
Col24a1 G T 3: 145,328,759 G580V probably damaging Het
Col6a2 A T 10: 76,604,105 N655K probably damaging Het
Ctsf A T 19: 4,859,840 Y416F possibly damaging Het
Dennd5a A C 7: 109,934,754 V77G probably damaging Het
Dna2 A T 10: 62,959,329 K460* probably null Het
Dnah17 A T 11: 118,060,271 M2842K probably damaging Het
Dnajc13 C A 9: 104,172,612 G1765V probably damaging Het
Donson A C 16: 91,683,763 C243W probably damaging Het
Dpp8 A T 9: 65,078,679 N817I possibly damaging Het
Eef1d G A 15: 75,896,806 probably benign Het
Esf1 T A 2: 140,168,359 D19V probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Gm9867 C A 4: 140,322,488 A128S unknown Het
Igsf23 G T 7: 19,941,737 probably benign Het
Kdm7a C A 6: 39,166,765 probably benign Het
Kif14 G A 1: 136,525,871 probably benign Het
Mroh7 T C 4: 106,680,793 N1229D possibly damaging Het
Mrps11 C A 7: 78,791,863 probably benign Het
Mtmr2 T A 9: 13,796,113 D248E probably damaging Het
Myrfl C A 10: 116,783,209 S748I probably benign Het
Nop14 T C 5: 34,650,520 E366G possibly damaging Het
Olfr225 C T 11: 59,613,654 T230I possibly damaging Het
Olfr273 T G 4: 52,855,764 I250L possibly damaging Het
Olfr618 A G 7: 103,598,131 I272V probably benign Het
Olfr873 T A 9: 20,300,565 C123S probably benign Het
Olfr971 C T 9: 39,840,283 P283L probably damaging Het
Phykpl G T 11: 51,585,539 E29* probably null Het
Plppr4 A G 3: 117,331,646 probably null Het
Prmt2 A C 10: 76,207,807 probably benign Het
Prodh2 T A 7: 30,494,224 Y114* probably null Het
Prr23a2 C A 9: 98,856,864 H92N probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rdx C A 9: 52,065,817 A122E probably damaging Het
Rspo3 T G 10: 29,454,257 D236A unknown Het
Sdk2 A T 11: 113,832,258 D1302E probably damaging Het
Sipa1 A T 19: 5,660,354 D209E probably damaging Het
Sirpa T G 2: 129,627,936 probably benign Het
Ska1 A C 18: 74,197,499 probably benign Het
Slc4a9 T C 18: 36,535,278 probably benign Het
Slco1b2 T C 6: 141,685,446 V602A probably benign Het
Slco2a1 T C 9: 103,082,334 V543A probably damaging Het
Sorcs3 A T 19: 48,693,994 L489F probably damaging Het
Sorl1 T C 9: 42,071,069 probably benign Het
Spindoc G T 19: 7,374,735 N82K probably benign Het
Stk17b C A 1: 53,757,492 C372F probably damaging Het
Tbck A G 3: 132,722,291 probably benign Het
Thoc1 C T 18: 9,963,267 T127I probably benign Het
Togaram2 G T 17: 71,716,444 R765L probably damaging Het
Tprg A G 16: 25,317,469 Y70C probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umodl1 T C 17: 30,996,351 Y1050H probably damaging Het
Vmn1r205 T A 13: 22,592,416 D172V probably benign Het
Vmn1r79 A T 7: 12,177,063 N291Y probably damaging Het
Vmn2r112 T A 17: 22,614,999 N549K probably damaging Het
Vrk3 T A 7: 44,764,803 L241Q probably damaging Het
Zc3h7a A G 16: 11,151,880 S386P probably damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGAAAACCCTGGAGTTAAGGACGC -3'
(R):5'- GGCTTTGTGATACCCTTCTACTGGC -3'

Sequencing Primer
(F):5'- GGCACTGTCCAGCTTCAATG -3'
(R):5'- GGCAGCCAATCTTGTTTTCAG -3'
Posted On2013-10-16