Incidental Mutation 'R0833:Rgs1'
ID 77602
Institutional Source Beutler Lab
Gene Symbol Rgs1
Ensembl Gene ENSMUSG00000026358
Gene Name regulator of G-protein signaling 1
Synonyms BL34
MMRRC Submission 039012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R0833 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 144120407-144124862 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144123671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 85 (S85T)
Ref Sequence ENSEMBL: ENSMUSP00000140624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167317] [ENSMUST00000169409] [ENSMUST00000172388] [ENSMUST00000185714] [ENSMUST00000189061]
AlphaFold Q9JL25
Predicted Effect probably benign
Transcript: ENSMUST00000167317
Predicted Effect probably benign
Transcript: ENSMUST00000167812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169042
Predicted Effect probably benign
Transcript: ENSMUST00000169409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170870
Predicted Effect probably benign
Transcript: ENSMUST00000172388
SMART Domains Protein: ENSMUSP00000130339
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185714
AA Change: S58T

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140902
Gene: ENSMUSG00000026358
AA Change: S58T

DomainStartEndE-ValueType
RGS 58 128 2.8e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189061
AA Change: S85T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140624
Gene: ENSMUSG00000026358
AA Change: S85T

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189916
Meta Mutation Damage Score 0.4829 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased splenic B cell germinal centers, increased chemotactic responses in B cells and immature dendritic cells, and decreased antibody secreting cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,000,931 (GRCm39) L41P probably damaging Het
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
Aldh1a7 C T 19: 20,679,607 (GRCm39) V390M probably damaging Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Arl2 T G 19: 6,186,052 (GRCm39) K126T probably damaging Het
Ascc3 T C 10: 50,721,762 (GRCm39) W2072R probably benign Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Asxl3 A G 18: 22,649,097 (GRCm39) D362G probably damaging Het
Bdp1 A T 13: 100,172,333 (GRCm39) H2094Q probably benign Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd226 A C 18: 89,225,144 (GRCm39) probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Clip1 T C 5: 123,768,784 (GRCm39) D605G probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fam219b A G 9: 57,445,299 (GRCm39) probably benign Het
Fryl A T 5: 73,246,424 (GRCm39) probably benign Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Gm14496 T C 2: 181,638,059 (GRCm39) W378R probably damaging Het
Gm57858 A G 3: 36,074,362 (GRCm39) probably benign Het
Gm8674 A T 13: 50,058,611 (GRCm39) noncoding transcript Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Grk2 C A 19: 4,339,385 (GRCm39) L428F probably damaging Het
Grm8 T A 6: 27,363,178 (GRCm39) E779V probably damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itih1 A T 14: 30,663,512 (GRCm39) V164E probably damaging Het
Itpka T A 2: 119,581,312 (GRCm39) N448K probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Lrfn5 A C 12: 61,886,454 (GRCm39) T81P probably damaging Het
Lrrc45 T A 11: 120,609,019 (GRCm39) probably null Het
Marchf6 T C 15: 31,480,437 (GRCm39) Y562C probably benign Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Meis1 G A 11: 18,831,767 (GRCm39) H424Y possibly damaging Het
Mst1r A G 9: 107,791,975 (GRCm39) N837S probably benign Het
Mst1r G A 9: 107,790,366 (GRCm39) V660I probably benign Het
Mthfd2l T C 5: 91,094,801 (GRCm39) V90A probably damaging Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Or10g3b T C 14: 52,586,835 (GRCm39) I223V probably benign Het
Or51g1 C A 7: 102,634,043 (GRCm39) L109F possibly damaging Het
Or8b12b T C 9: 37,684,372 (GRCm39) V139A probably benign Het
Otog C T 7: 45,918,786 (GRCm39) T954I possibly damaging Het
Pdcd6 A G 13: 74,464,443 (GRCm39) probably benign Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Pramel18 G A 4: 101,767,294 (GRCm39) C181Y probably damaging Het
Pramel23 A T 4: 143,425,056 (GRCm39) M129K probably benign Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Samd9l T C 6: 3,372,725 (GRCm39) E1512G possibly damaging Het
Sgsm1 C T 5: 113,427,050 (GRCm39) A127T probably benign Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc26a1 T A 5: 108,821,389 (GRCm39) T167S probably benign Het
Slc26a7 A T 4: 14,593,873 (GRCm39) Y81N probably damaging Het
Slc2a12 T C 10: 22,577,915 (GRCm39) probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc44a5 T C 3: 153,971,111 (GRCm39) S654P probably damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Syvn1 C T 19: 6,102,483 (GRCm39) P517L probably benign Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tgm3 C T 2: 129,868,602 (GRCm39) probably benign Het
Tle2 T C 10: 81,424,781 (GRCm39) F667L probably damaging Het
Tnfaip3 C A 10: 18,878,697 (GRCm39) A704S probably benign Het
Trabd2b A G 4: 114,437,519 (GRCm39) Q232R probably benign Het
Ttc28 T A 5: 111,378,947 (GRCm39) I1144N probably damaging Het
Ucp3 T A 7: 100,128,748 (GRCm39) C25* probably null Het
Ugt3a1 A G 15: 9,370,236 (GRCm39) D460G probably damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Ush1g G T 11: 115,209,694 (GRCm39) R167S possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r108 A T 17: 20,691,721 (GRCm39) D267E probably benign Het
Zng1 A G 19: 24,918,203 (GRCm39) probably benign Het
Other mutations in Rgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Rgs1 APN 1 144,121,116 (GRCm39) missense probably damaging 1.00
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0149:Rgs1 UTSW 1 144,124,825 (GRCm39) start gained probably benign
R0295:Rgs1 UTSW 1 144,121,224 (GRCm39) missense probably damaging 1.00
R0836:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R1585:Rgs1 UTSW 1 144,121,227 (GRCm39) critical splice acceptor site probably null
R4373:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4375:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4769:Rgs1 UTSW 1 144,123,667 (GRCm39) missense probably damaging 1.00
R4961:Rgs1 UTSW 1 144,124,309 (GRCm39) splice site probably null
R4992:Rgs1 UTSW 1 144,122,060 (GRCm39) missense probably damaging 1.00
R5427:Rgs1 UTSW 1 144,122,018 (GRCm39) nonsense probably null
R5614:Rgs1 UTSW 1 144,121,995 (GRCm39) missense probably benign 0.18
R5743:Rgs1 UTSW 1 144,121,110 (GRCm39) missense probably damaging 1.00
R7315:Rgs1 UTSW 1 144,124,637 (GRCm39) critical splice donor site probably null
R7491:Rgs1 UTSW 1 144,121,134 (GRCm39) missense probably damaging 1.00
R7633:Rgs1 UTSW 1 144,124,215 (GRCm39) critical splice donor site probably null
R9640:Rgs1 UTSW 1 144,121,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGAACACATGTAACTGTTTTGGCA -3'
(R):5'- TCCCACATCTGGAATCTGGGATGAA -3'

Sequencing Primer
(F):5'- AAGGACAGTGATAAAAATCTAGTGC -3'
(R):5'- tggaggttgagacagggg -3'
Posted On 2013-10-16