Incidental Mutation 'R0833:Apoa2'
ID 77603
Institutional Source Beutler Lab
Gene Symbol Apoa2
Ensembl Gene ENSMUSG00000005681
Gene Name apolipoprotein A-II
Synonyms ApoA-II, Hdl-1, Alp-2, Apoa-2
MMRRC Submission 039012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R0833 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 171225054-171226379 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 171225379 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005824] [ENSMUST00000079957] [ENSMUST00000111319] [ENSMUST00000111320] [ENSMUST00000111321] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000138184] [ENSMUST00000143405] [ENSMUST00000147246] [ENSMUST00000193973] [ENSMUST00000155126]
AlphaFold P09813
Predicted Effect probably benign
Transcript: ENSMUST00000005817
SMART Domains Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 7.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000005824
SMART Domains Protein: ENSMUSP00000005824
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079957
SMART Domains Protein: ENSMUSP00000078875
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 51 3.7e-19 PFAM
ITAM 62 82 9.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111319
SMART Domains Protein: ENSMUSP00000106951
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 98 2.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111320
SMART Domains Protein: ENSMUSP00000106952
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111321
SMART Domains Protein: ENSMUSP00000106953
Gene: ENSMUSG00000005681

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111326
SMART Domains Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 95 9e-16 PFAM
Pfam:Porin_3 85 268 1.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111327
SMART Domains Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 302 3.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130529
Predicted Effect probably benign
Transcript: ENSMUST00000138184
SMART Domains Protein: ENSMUSP00000115877
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 119 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143405
Predicted Effect probably benign
Transcript: ENSMUST00000147246
SMART Domains Protein: ENSMUSP00000119006
Gene: ENSMUSG00000005674

DomainStartEndE-ValueType
Pfam:Porin_3 26 91 5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154106
Predicted Effect probably benign
Transcript: ENSMUST00000193973
SMART Domains Protein: ENSMUSP00000141240
Gene: ENSMUSG00000058715

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TCR_zetazeta 21 53 4.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155126
SMART Domains Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677

DomainStartEndE-ValueType
HOLI 36 196 5.55e-29 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: This gene encodes a component of high density lipoproteins (HDL). Mice lacking the encoded protein have low HDL-cholesterol levels, smaller HDL particles, increased clearance of triglyceride-rich lipoproteins and insulin hypersensitivity. Transgenic mice overexpressing the encoded protein have elevated levels of HDL-cholesterol and show increased susceptibility to atherosclerosis. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mutation of this gene results in a reduction of total cholesterol, HDL cholesterol, free fatty acids, insulin, and glucose levels in both the fasted and unfasted states. Strain specific alleles have been associated with varying degrees of amyloidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
Aldh1a7 C T 19: 20,702,243 V390M probably damaging Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Arl2 T G 19: 6,136,022 K126T probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Astl T C 2: 127,342,419 F21L probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbwd1 A G 19: 24,940,839 probably benign Het
Ccdc144b A G 3: 36,020,213 probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fam219b A G 9: 57,538,016 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Gm12800 G A 4: 101,910,097 C181Y probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm14496 T C 2: 181,996,266 W378R probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm8674 A T 13: 49,904,575 noncoding transcript Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Grk2 C A 19: 4,289,357 L428F probably damaging Het
Grm8 T A 6: 27,363,179 E779V probably damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc45 T A 11: 120,718,193 probably null Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Meis1 G A 11: 18,881,767 H424Y possibly damaging Het
Mst1r G A 9: 107,913,167 V660I probably benign Het
Mst1r A G 9: 107,914,776 N837S probably benign Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr578 C A 7: 102,984,836 L109F possibly damaging Het
Olfr875 T C 9: 37,773,076 V139A probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Syvn1 C T 19: 6,052,453 P517L probably benign Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Ucp3 T A 7: 100,479,541 C25* probably null Het
Ugt3a2 A G 15: 9,370,150 D460G probably damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Ush1g G T 11: 115,318,868 R167S possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Other mutations in Apoa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0836:Apoa2 UTSW 1 171225379 unclassified probably benign
R0945:Apoa2 UTSW 1 171225699 splice site probably null
R2230:Apoa2 UTSW 1 171225771 missense probably benign 0.00
R4866:Apoa2 UTSW 1 171225800 critical splice donor site probably null
R7736:Apoa2 UTSW 1 171226172 missense probably damaging 0.98
R8548:Apoa2 UTSW 1 171226229 missense probably benign 0.05
R9308:Apoa2 UTSW 1 171225731 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GTTCACTGTGACACCAAGAGTCCC -3'
(R):5'- AGACTGCCAGCAATGAATCCCG -3'

Sequencing Primer
(F):5'- GCTAAGTTAGAGTGAGCATCCATC -3'
(R):5'- CAAATTGGTGGCCTGCTACG -3'
Posted On 2013-10-16