Incidental Mutation 'R0833:Astl'
ID77607
Institutional Source Beutler Lab
Gene Symbol Astl
Ensembl Gene ENSMUSG00000050468
Gene Nameastacin-like metalloendopeptidase (M12 family)
SynonymsSas1b, C87576, Ovastacin
MMRRC Submission 039012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R0833 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127338639-127357651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127342419 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 21 (F21L)
Ref Sequence ENSEMBL: ENSMUSP00000135987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028846] [ENSMUST00000059839] [ENSMUST00000089673] [ENSMUST00000156747] [ENSMUST00000179618]
Predicted Effect probably benign
Transcript: ENSMUST00000028846
SMART Domains Protein: ENSMUSP00000028846
Gene: ENSMUSG00000027368

DomainStartEndE-ValueType
RHOD 17 145 6.72e-10 SMART
DSPc 176 314 1.49e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059839
AA Change: F21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054456
Gene: ENSMUSG00000050468
AA Change: F21L

DomainStartEndE-ValueType
Blast:ZnMc 31 60 4e-8 BLAST
ZnMc 69 213 1.13e-39 SMART
low complexity region 292 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089673
AA Change: F42L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087102
Gene: ENSMUSG00000050468
AA Change: F42L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Blast:ZnMc 52 81 5e-8 BLAST
ZnMc 90 234 1.13e-39 SMART
low complexity region 313 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146479
Predicted Effect probably benign
Transcript: ENSMUST00000156747
AA Change: F21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116771
Gene: ENSMUSG00000050468
AA Change: F21L

DomainStartEndE-ValueType
Blast:ZnMc 31 60 6e-9 BLAST
ZnMc 69 193 4.02e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179618
AA Change: F21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135987
Gene: ENSMUSG00000050468
AA Change: F21L

DomainStartEndE-ValueType
Blast:ZnMc 31 60 4e-8 BLAST
ZnMc 69 213 1.13e-39 SMART
low complexity region 292 308 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (97/97)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out alleles exhibit reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
Aldh1a7 C T 19: 20,702,243 V390M probably damaging Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Arl2 T G 19: 6,136,022 K126T probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbwd1 A G 19: 24,940,839 probably benign Het
Ccdc144b A G 3: 36,020,213 probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fam219b A G 9: 57,538,016 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Gm12800 G A 4: 101,910,097 C181Y probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm14496 T C 2: 181,996,266 W378R probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm8674 A T 13: 49,904,575 noncoding transcript Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Grk2 C A 19: 4,289,357 L428F probably damaging Het
Grm8 T A 6: 27,363,179 E779V probably damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc45 T A 11: 120,718,193 probably null Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Meis1 G A 11: 18,881,767 H424Y possibly damaging Het
Mst1r G A 9: 107,913,167 V660I probably benign Het
Mst1r A G 9: 107,914,776 N837S probably benign Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr578 C A 7: 102,984,836 L109F possibly damaging Het
Olfr875 T C 9: 37,773,076 V139A probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Syvn1 C T 19: 6,052,453 P517L probably benign Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Ucp3 T A 7: 100,479,541 C25* probably null Het
Ugt3a2 A G 15: 9,370,150 D460G probably damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Ush1g G T 11: 115,318,868 R167S possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Other mutations in Astl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Astl APN 2 127344021 splice site probably null
IGL01952:Astl APN 2 127342478 critical splice donor site probably null
R0836:Astl UTSW 2 127342419 missense probably benign
R1351:Astl UTSW 2 127347185 missense possibly damaging 0.95
R1672:Astl UTSW 2 127347243 missense probably damaging 1.00
R1809:Astl UTSW 2 127345485 missense probably damaging 1.00
R2145:Astl UTSW 2 127347189 missense probably damaging 1.00
R5669:Astl UTSW 2 127347279 missense probably damaging 1.00
R6057:Astl UTSW 2 127345969 missense probably benign
R6912:Astl UTSW 2 127356386 missense probably benign 0.09
R7071:Astl UTSW 2 127345965 missense probably benign 0.00
R7998:Astl UTSW 2 127350499 missense probably damaging 1.00
R8039:Astl UTSW 2 127343983 missense probably damaging 1.00
Z1176:Astl UTSW 2 127356545 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATAGCCAGGCAGGCTTCAGGAATG -3'
(R):5'- CGCTTACACACCGCTACTTACAGAG -3'

Sequencing Primer
(F):5'- AGGCTTCAGGAATGCATCC -3'
(R):5'- ACCGCTACTTACAGAGAGATTG -3'
Posted On2013-10-16