Mutagenetix > Incidental Mutations

Incidental Mutation 'R0833:Vav3'

77615

Institutional Source

Beutler Lab

Gene Symbol

Vav3

Ensembl Gene

ENSMUSG00000033721

Gene Name

vav 3 oncogene

Synonyms

Idd18.1, A530094I06Rik

MMRRC Submission

039012-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R0833 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109340653-109685698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109647679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 81 (N81S)

Ref Sequence

ENSEMBL: ENSMUSP00000102186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046864] [ENSMUST00000106576]

AlphaFold

Q9R0C8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046864
AA Change: N641S

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036270
Gene: ENSMUSG00000033721
AA Change: N641S

Domain	Start	End	E-Value	Type
CH	3	115	2.1e-18	SMART
low complexity region	160	175	N/A	INTRINSIC
RhoGEF	196	370	5.09e-56	SMART
PH	401	504	1.88e-9	SMART
C1	514	562	2.17e-11	SMART
SH3	595	659	6.4e-6	SMART
SH2	670	752	2.59e-26	SMART
SH3	791	847	8.96e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106576
AA Change: N81S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102186
Gene: ENSMUSG00000033721
AA Change: N81S

Domain	Start	End	E-Value	Type
SH3	35	99	3.8e-8	SMART
SH2	110	192	1.6e-28	SMART
SH3	233	289	5.5e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148866

SMART Domains

Protein: ENSMUSP00000121660
Gene: ENSMUSG00000033721

Domain	Start	End	E-Value	Type
SH2	33	115	2.59e-26	SMART
PDB:2KBT\|A	149	179	6e-6	PDB
Blast:SH3	154	179	2e-10	BLAST

Meta Mutation Damage Score

0.1090

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.6%

Validation Efficiency

100% (97/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in tachycardia, systemic arterial hypertension, cardiovascular remodeling, hyperactivity of sympathetic neurons and thus high catecholamine levels, and increased levels of kidney-related hormones. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
3110082I17Rik	A	G	5: 139,364,120	V58A	possibly damaging	Het
4932415M13Rik	A	T	17: 53,724,346		noncoding transcript	Het
Aldh1a7	C	T	19: 20,702,243	V390M	probably damaging	Het
Alg14	A	G	3: 121,298,610	H34R	probably damaging	Het
Ankrd27	A	G	7: 35,608,347	N337S	probably damaging	Het
Apoa2	T	A	1: 171,225,379		probably benign	Het
Arl2	T	G	19: 6,136,022	K126T	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Astl	T	C	2: 127,342,419	F21L	probably benign	Het
Asxl3	A	G	18: 22,516,040	D362G	probably damaging	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cbwd1	A	G	19: 24,940,839		probably benign	Het
Ccdc144b	A	G	3: 36,020,213		probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Ces1f	A	T	8: 93,270,024	S214T	probably damaging	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Col26a1	A	G	5: 136,765,300		probably null	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
D17H6S53E	A	T	17: 35,127,409		probably null	Het
D17Wsu92e	A	T	17: 27,786,138	S148R	probably damaging	Het
Dnah11	G	A	12: 118,196,662	A111V	probably benign	Het
Dyrk2	T	C	10: 118,861,122	H77R	probably benign	Het
E330017A01Rik	G	A	16: 58,635,523	S129L	probably damaging	Het
Epha3	A	G	16: 63,603,519		probably benign	Het
Epn2	T	C	11: 61,519,491	N611S	probably benign	Het
Erich6	A	C	3: 58,618,944		probably benign	Het
Fam217b	T	C	2: 178,420,989	S249P	probably benign	Het
Fam219b	A	G	9: 57,538,016		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Gm12800	G	A	4: 101,910,097	C181Y	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm14496	T	C	2: 181,996,266	W378R	probably damaging	Het
Gm5155	C	A	7: 17,904,981	A301E	possibly damaging	Het
Gm8674	A	T	13: 49,904,575		noncoding transcript	Het
Grap	T	A	11: 61,660,239	D32E	possibly damaging	Het
Grk2	C	A	19: 4,289,357	L428F	probably damaging	Het
Grm8	T	A	6: 27,363,179	E779V	probably damaging	Het
Hipk1	A	G	3: 103,754,296	S670P	probably damaging	Het
Itgae	A	T	11: 73,129,206	M845L	probably benign	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Itpka	T	A	2: 119,750,831	N448K	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc45	T	A	11: 120,718,193		probably null	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Meis1	G	A	11: 18,881,767	H424Y	possibly damaging	Het
Mst1r	G	A	9: 107,913,167	V660I	probably benign	Het
Mst1r	A	G	9: 107,914,776	N837S	probably benign	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr578	C	A	7: 102,984,836	L109F	possibly damaging	Het
Olfr875	T	C	9: 37,773,076	V139A	probably benign	Het
Otog	C	T	7: 46,269,362	T954I	possibly damaging	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Phlpp2	A	G	8: 109,937,106	T926A	probably damaging	Het
Plec	GGCAGCAG	GGCAGCAGCAG	15: 76,181,907		probably benign	Het
Plekha5	T	A	6: 140,589,634		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rasd1	A	T	11: 59,964,553	F85I	probably damaging	Het
Rgs1	A	T	1: 144,247,933	S85T	probably damaging	Het
Samd9l	T	C	6: 3,372,725	E1512G	possibly damaging	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Shc1	A	G	3: 89,422,969	D70G	probably damaging	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc26a7	A	T	4: 14,593,873	Y81N	probably damaging	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc30a7	T	A	3: 115,990,140		probably null	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Stard9	T	G	2: 120,696,999	S1246A	possibly damaging	Het
Stxbp5	A	T	10: 9,865,099	S116R	probably damaging	Het
Syvn1	C	T	19: 6,052,453	P517L	probably benign	Het
Tas2r105	T	C	6: 131,687,430	I12V	probably benign	Het
Tas2r121	A	G	6: 132,700,362	S216P	probably damaging	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tgm3	C	T	2: 130,026,682		probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Ucp3	T	A	7: 100,479,541	C25*	probably null	Het
Ugt3a2	A	G	15: 9,370,150	D460G	probably damaging	Het
Urb1	T	C	16: 90,795,448	D308G	possibly damaging	Het
Ush1g	G	T	11: 115,318,868	R167S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,459	D267E	probably benign	Het

Other mutations in Vav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Vav3	APN	3	109528392	splice site	probably benign
IGL01488:Vav3	APN	3	109657944	missense	probably damaging	0.99
IGL01649:Vav3	APN	3	109562762	missense	probably benign
IGL01675:Vav3	APN	3	109664413	missense	probably benign	0.16
IGL02189:Vav3	APN	3	109525960	splice site	probably benign
IGL03134:Vav3	APN	3	109563094	splice site	probably benign
IGL03358:Vav3	APN	3	109647673	missense	probably damaging	1.00
PIT4131001:Vav3	UTSW	3	109664435	critical splice donor site	probably null
R0511:Vav3	UTSW	3	109664440	splice site	probably benign
R0542:Vav3	UTSW	3	109527430	missense	probably damaging	1.00
R0630:Vav3	UTSW	3	109424012	missense	probably damaging	1.00
R0683:Vav3	UTSW	3	109651813	missense	probably benign	0.04
R0836:Vav3	UTSW	3	109647679	missense	possibly damaging	0.93
R0940:Vav3	UTSW	3	109562835	missense	possibly damaging	0.78
R1561:Vav3	UTSW	3	109494838	critical splice donor site	probably null
R1617:Vav3	UTSW	3	109510978	missense	probably damaging	1.00
R1760:Vav3	UTSW	3	109341127	missense	possibly damaging	0.61
R1834:Vav3	UTSW	3	109506426	missense	probably benign	0.06
R1928:Vav3	UTSW	3	109506422	missense	possibly damaging	0.94
R2090:Vav3	UTSW	3	109647739	critical splice donor site	probably null
R2190:Vav3	UTSW	3	109562814	missense	probably damaging	1.00
R2483:Vav3	UTSW	3	109341166	missense	probably damaging	1.00
R3124:Vav3	UTSW	3	109628168	critical splice donor site	probably null
R3125:Vav3	UTSW	3	109628168	critical splice donor site	probably null
R3800:Vav3	UTSW	3	109628039	missense	probably benign	0.45
R3919:Vav3	UTSW	3	109527538	missense	possibly damaging	0.51
R4693:Vav3	UTSW	3	109563218	splice site	probably benign
R4779:Vav3	UTSW	3	109508794	missense	possibly damaging	0.88
R5384:Vav3	UTSW	3	109527475	missense	possibly damaging	0.92
R5385:Vav3	UTSW	3	109527475	missense	possibly damaging	0.92
R5474:Vav3	UTSW	3	109664421	missense	probably benign
R5703:Vav3	UTSW	3	109341241	missense	probably benign	0.13
R5997:Vav3	UTSW	3	109501461	missense	probably damaging	1.00
R6109:Vav3	UTSW	3	109664365	missense	probably damaging	1.00
R6110:Vav3	UTSW	3	109664365	missense	probably damaging	1.00
R6120:Vav3	UTSW	3	109664365	missense	probably damaging	1.00
R6123:Vav3	UTSW	3	109664365	missense	probably damaging	1.00
R6124:Vav3	UTSW	3	109664365	missense	probably damaging	1.00
R6186:Vav3	UTSW	3	109516067	missense	probably damaging	1.00
R6291:Vav3	UTSW	3	109508854	missense	possibly damaging	0.82
R6335:Vav3	UTSW	3	109563196	missense	probably benign	0.01
R6647:Vav3	UTSW	3	109527416	missense	probably benign	0.19
R6849:Vav3	UTSW	3	109521466	missense	probably damaging	1.00
R6897:Vav3	UTSW	3	109527494	missense	probably damaging	1.00
R7075:Vav3	UTSW	3	109525924	missense	possibly damaging	0.47
R7131:Vav3	UTSW	3	109664346	missense	probably damaging	1.00
R7328:Vav3	UTSW	3	109503428	missense	probably benign	0.10
R7365:Vav3	UTSW	3	109628099	missense	possibly damaging	0.67
R7991:Vav3	UTSW	3	109563162	missense	probably damaging	1.00
R8151:Vav3	UTSW	3	109508848	missense	probably benign
R8164:Vav3	UTSW	3	109341052	missense	probably benign
R8170:Vav3	UTSW	3	109424007	missense	probably damaging	1.00
R8527:Vav3	UTSW	3	109503471	missense	probably damaging	0.98
R8542:Vav3	UTSW	3	109503471	missense	probably damaging	0.98
R8734:Vav3	UTSW	3	109657969	missense	probably benign	0.00
R8828:Vav3	UTSW	3	109647735	missense	probably benign	0.00
R8963:Vav3	UTSW	3	109682913	missense	probably damaging	1.00
R9032:Vav3	UTSW	3	109506406	missense	probably benign
R9085:Vav3	UTSW	3	109506406	missense	probably benign
R9387:Vav3	UTSW	3	109657975	missense	probably benign	0.39
R9393:Vav3	UTSW	3	109578366	critical splice donor site	probably null
R9429:Vav3	UTSW	3	109657245	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCAATAGGCAAGCAACCCTGAG -3'
(R):5'- TCCTGTAACCTGAGTGACCAGGAG -3'

Sequencing Primer
(F):5'- AACCCTGAGGATACTGCGTTG -3'
(R):5'- GGAGCAGGTTAGACCATTTACCC -3'

Posted On

2013-10-16