Incidental Mutation 'R0833:Ttc28'
ID77626
Institutional Source Beutler Lab
Gene Symbol Ttc28
Ensembl Gene ENSMUSG00000033209
Gene Nametetratricopeptide repeat domain 28
Synonyms
MMRRC Submission 039012-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0833 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110879803-111289780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111231081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1144 (I1144N)
Ref Sequence ENSEMBL: ENSMUSP00000137609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]
Predicted Effect probably damaging
Transcript: ENSMUST00000040111
AA Change: I1175N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: I1175N

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 339 372 1.78e-1 SMART
TPR 379 412 2.82e-4 SMART
TPR 419 452 9.98e-5 SMART
TPR 459 492 1.88e0 SMART
TPR 499 532 1.11e1 SMART
TPR 539 572 2.93e-2 SMART
TPR 579 612 1.21e-3 SMART
TPR 619 652 4.91e-4 SMART
TPR 659 692 7.56e-5 SMART
TPR 699 732 8.29e0 SMART
TPR 739 772 1.63e0 SMART
TPR 779 812 1.24e0 SMART
TPR 819 852 7.98e-4 SMART
TPR 859 892 8.74e0 SMART
TPR 902 935 5.43e-6 SMART
TPR 942 975 4.09e-1 SMART
TPR 982 1015 9.98e-5 SMART
TPR 1022 1055 7.12e-1 SMART
TPR 1062 1095 5.69e0 SMART
TPR 1102 1135 3.14e-2 SMART
TPR 1142 1175 2.84e1 SMART
low complexity region 1259 1277 N/A INTRINSIC
Pfam:CHAT 1415 1738 7.3e-77 PFAM
low complexity region 1972 1990 N/A INTRINSIC
low complexity region 2014 2031 N/A INTRINSIC
low complexity region 2033 2045 N/A INTRINSIC
low complexity region 2155 2171 N/A INTRINSIC
low complexity region 2283 2293 N/A INTRINSIC
low complexity region 2327 2352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129017
Predicted Effect probably damaging
Transcript: ENSMUST00000156290
AA Change: I1144N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: I1144N

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 308 341 1.78e-1 SMART
TPR 348 381 2.82e-4 SMART
TPR 388 421 9.98e-5 SMART
TPR 428 461 1.88e0 SMART
TPR 468 501 1.11e1 SMART
TPR 508 541 2.93e-2 SMART
TPR 548 581 1.21e-3 SMART
TPR 588 621 4.91e-4 SMART
TPR 628 661 7.56e-5 SMART
TPR 668 701 8.29e0 SMART
TPR 708 741 1.63e0 SMART
TPR 748 781 1.24e0 SMART
TPR 788 821 7.98e-4 SMART
TPR 828 861 8.74e0 SMART
TPR 871 904 5.43e-6 SMART
TPR 911 944 4.09e-1 SMART
TPR 951 984 9.98e-5 SMART
TPR 991 1024 7.12e-1 SMART
TPR 1031 1064 5.69e0 SMART
TPR 1071 1104 3.14e-2 SMART
TPR 1111 1144 2.84e1 SMART
low complexity region 1228 1246 N/A INTRINSIC
Pfam:CHAT 1384 1707 1.1e-76 PFAM
low complexity region 1941 1959 N/A INTRINSIC
low complexity region 1983 2000 N/A INTRINSIC
low complexity region 2002 2014 N/A INTRINSIC
low complexity region 2124 2140 N/A INTRINSIC
low complexity region 2252 2262 N/A INTRINSIC
low complexity region 2296 2321 N/A INTRINSIC
Meta Mutation Damage Score 0.7062 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (97/97)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
Aldh1a7 C T 19: 20,702,243 V390M probably damaging Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Arl2 T G 19: 6,136,022 K126T probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Astl T C 2: 127,342,419 F21L probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbwd1 A G 19: 24,940,839 probably benign Het
Ccdc144b A G 3: 36,020,213 probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fam219b A G 9: 57,538,016 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Gm12800 G A 4: 101,910,097 C181Y probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm14496 T C 2: 181,996,266 W378R probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm8674 A T 13: 49,904,575 noncoding transcript Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Grk2 C A 19: 4,289,357 L428F probably damaging Het
Grm8 T A 6: 27,363,179 E779V probably damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc45 T A 11: 120,718,193 probably null Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Meis1 G A 11: 18,881,767 H424Y possibly damaging Het
Mst1r G A 9: 107,913,167 V660I probably benign Het
Mst1r A G 9: 107,914,776 N837S probably benign Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr578 C A 7: 102,984,836 L109F possibly damaging Het
Olfr875 T C 9: 37,773,076 V139A probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Syvn1 C T 19: 6,052,453 P517L probably benign Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Ucp3 T A 7: 100,479,541 C25* probably null Het
Ugt3a2 A G 15: 9,370,150 D460G probably damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Ush1g G T 11: 115,318,868 R167S possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Other mutations in Ttc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ttc28 APN 5 111225688 missense probably damaging 1.00
IGL00963:Ttc28 APN 5 111286389 nonsense probably null
IGL00969:Ttc28 APN 5 111225740 missense probably benign 0.00
IGL01366:Ttc28 APN 5 111085171 critical splice donor site probably null
IGL01528:Ttc28 APN 5 111101960 splice site probably benign
IGL01558:Ttc28 APN 5 111283962 missense probably damaging 0.99
IGL01973:Ttc28 APN 5 111224235 missense possibly damaging 0.88
IGL02040:Ttc28 APN 5 110892936 nonsense probably null
IGL02432:Ttc28 APN 5 111223235 missense probably damaging 1.00
IGL02531:Ttc28 APN 5 111225850 missense probably damaging 1.00
IGL02819:Ttc28 APN 5 111266583 missense probably benign
IGL02830:Ttc28 APN 5 111286239 missense probably benign 0.10
IGL02893:Ttc28 APN 5 111285385 missense possibly damaging 0.87
IGL03387:Ttc28 APN 5 111233342 missense probably benign 0.07
PIT4131001:Ttc28 UTSW 5 110892853 missense probably benign 0.00
R0142:Ttc28 UTSW 5 111277457 missense probably benign 0.40
R0166:Ttc28 UTSW 5 111225634 missense probably benign 0.01
R0328:Ttc28 UTSW 5 111284067 splice site probably benign
R0582:Ttc28 UTSW 5 111183296 missense probably damaging 1.00
R0744:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R0811:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0812:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0828:Ttc28 UTSW 5 111223446 missense probably damaging 1.00
R1013:Ttc28 UTSW 5 111276965 missense probably benign 0.01
R1168:Ttc28 UTSW 5 111231111 missense probably damaging 1.00
R1194:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1196:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1205:Ttc28 UTSW 5 111285769 missense probably benign 0.04
R1386:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1537:Ttc28 UTSW 5 111285318 missense probably damaging 0.96
R1539:Ttc28 UTSW 5 111100811 missense possibly damaging 0.77
R1558:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1560:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1561:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1566:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1768:Ttc28 UTSW 5 111277168 missense possibly damaging 0.77
R1775:Ttc28 UTSW 5 111276811 missense probably benign 0.00
R1909:Ttc28 UTSW 5 111284054 critical splice donor site probably null
R1911:Ttc28 UTSW 5 111280750 missense possibly damaging 0.93
R1970:Ttc28 UTSW 5 111235635 missense probably benign 0.00
R1990:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R1992:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R2066:Ttc28 UTSW 5 111225933 missense probably benign 0.01
R2112:Ttc28 UTSW 5 111276273 missense probably damaging 0.99
R2158:Ttc28 UTSW 5 111177617 intron probably benign
R2192:Ttc28 UTSW 5 111223496 missense probably damaging 0.99
R2267:Ttc28 UTSW 5 111226003 missense possibly damaging 0.75
R2384:Ttc28 UTSW 5 111276208 missense possibly damaging 0.95
R2989:Ttc28 UTSW 5 111224015 missense probably benign 0.29
R3881:Ttc28 UTSW 5 111183240 missense probably damaging 1.00
R3919:Ttc28 UTSW 5 111285379 missense possibly damaging 0.80
R4455:Ttc28 UTSW 5 111224058 frame shift probably null
R4456:Ttc28 UTSW 5 111224058 frame shift probably null
R4522:Ttc28 UTSW 5 111280172 missense probably benign 0.01
R4548:Ttc28 UTSW 5 111271224 missense possibly damaging 0.86
R4591:Ttc28 UTSW 5 111223281 missense probably damaging 1.00
R4633:Ttc28 UTSW 5 111224001 missense probably damaging 1.00
R4700:Ttc28 UTSW 5 111277043 missense probably damaging 1.00
R4714:Ttc28 UTSW 5 111285229 missense possibly damaging 0.65
R4790:Ttc28 UTSW 5 111224217 missense possibly damaging 0.94
R4803:Ttc28 UTSW 5 111277463 missense possibly damaging 0.90
R4840:Ttc28 UTSW 5 111286081 missense probably damaging 1.00
R4969:Ttc28 UTSW 5 111276255 missense probably damaging 0.96
R5019:Ttc28 UTSW 5 111102064 missense possibly damaging 0.47
R5130:Ttc28 UTSW 5 110892856 missense probably benign
R5150:Ttc28 UTSW 5 111225689 missense probably damaging 1.00
R5214:Ttc28 UTSW 5 111177623 intron probably benign
R5254:Ttc28 UTSW 5 111271238 missense probably benign 0.01
R5518:Ttc28 UTSW 5 111225928 missense probably benign 0.17
R5851:Ttc28 UTSW 5 111235469 splice site probably benign
R5931:Ttc28 UTSW 5 111085109 missense possibly damaging 0.81
R6011:Ttc28 UTSW 5 111286443 missense probably benign
R6176:Ttc28 UTSW 5 111223985 missense probably damaging 1.00
R6221:Ttc28 UTSW 5 111271248 missense probably benign 0.00
R6398:Ttc28 UTSW 5 111276276 missense probably damaging 1.00
R6717:Ttc28 UTSW 5 111285436 missense probably benign
R6770:Ttc28 UTSW 5 111286140 missense probably damaging 1.00
R6901:Ttc28 UTSW 5 111277025 missense possibly damaging 0.88
R7038:Ttc28 UTSW 5 111266579 missense probably benign 0.09
R7073:Ttc28 UTSW 5 111223416 missense possibly damaging 0.96
R7101:Ttc28 UTSW 5 111085092 missense probably damaging 1.00
R7135:Ttc28 UTSW 5 111280007 missense probably damaging 1.00
R7350:Ttc28 UTSW 5 111226037 missense probably damaging 0.97
R7454:Ttc28 UTSW 5 111285484 missense probably benign 0.19
R7461:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7596:Ttc28 UTSW 5 111280124 missense probably damaging 1.00
R7613:Ttc28 UTSW 5 111224129 missense probably damaging 1.00
R7625:Ttc28 UTSW 5 111285219 missense possibly damaging 0.65
R7648:Ttc28 UTSW 5 111183392 missense possibly damaging 0.52
R8030:Ttc28 UTSW 5 111286056 missense possibly damaging 0.81
V8831:Ttc28 UTSW 5 111100712 missense probably benign 0.11
Z1088:Ttc28 UTSW 5 111286315 missense probably benign 0.00
Z1176:Ttc28 UTSW 5 111266566 missense possibly damaging 0.59
Z1177:Ttc28 UTSW 5 111278586 missense probably damaging 1.00
Z1177:Ttc28 UTSW 5 111285739 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTTCAGCCCACAAGTCCTAATCGTC -3'
(R):5'- GGTCTGCACTGATTACCGAACCAC -3'

Sequencing Primer
(F):5'- CTCATCTGTCAAAGATTGGTCACG -3'
(R):5'- TACCGAACCACGGGCTTTG -3'
Posted On2013-10-16