Mutagenetix > Incidental Mutation

Incidental Mutation 'R0833:Mst1r'

77650

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

039012-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.288) question?

Stock #

R0833 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107914776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 837 (N837S)

Ref Sequence

ENSEMBL: ENSMUSP00000035203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably benign
Transcript: ENSMUST00000035203
AA Change: N837S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: N837S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194527

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195113

Predicted Effect

probably benign
Transcript: ENSMUST00000195617

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.6%

Validation Efficiency

100% (97/97)

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
3110082I17Rik	A	G	5: 139,364,120	V58A	possibly damaging	Het
4932415M13Rik	A	T	17: 53,724,346		noncoding transcript	Het
Aldh1a7	C	T	19: 20,702,243	V390M	probably damaging	Het
Alg14	A	G	3: 121,298,610	H34R	probably damaging	Het
Ankrd27	A	G	7: 35,608,347	N337S	probably damaging	Het
Apoa2	T	A	1: 171,225,379		probably benign	Het
Arl2	T	G	19: 6,136,022	K126T	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Astl	T	C	2: 127,342,419	F21L	probably benign	Het
Asxl3	A	G	18: 22,516,040	D362G	probably damaging	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cbwd1	A	G	19: 24,940,839		probably benign	Het
Ccdc144b	A	G	3: 36,020,213		probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Ces1f	A	T	8: 93,270,024	S214T	probably damaging	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Col26a1	A	G	5: 136,765,300		probably null	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
D17H6S53E	A	T	17: 35,127,409		probably null	Het
D17Wsu92e	A	T	17: 27,786,138	S148R	probably damaging	Het
Dnah11	G	A	12: 118,196,662	A111V	probably benign	Het
Dyrk2	T	C	10: 118,861,122	H77R	probably benign	Het
E330017A01Rik	G	A	16: 58,635,523	S129L	probably damaging	Het
Epha3	A	G	16: 63,603,519		probably benign	Het
Epn2	T	C	11: 61,519,491	N611S	probably benign	Het
Erich6	A	C	3: 58,618,944		probably benign	Het
Fam217b	T	C	2: 178,420,989	S249P	probably benign	Het
Fam219b	A	G	9: 57,538,016		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Gm12800	G	A	4: 101,910,097	C181Y	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm14496	T	C	2: 181,996,266	W378R	probably damaging	Het
Gm5155	C	A	7: 17,904,981	A301E	possibly damaging	Het
Gm8674	A	T	13: 49,904,575		noncoding transcript	Het
Grap	T	A	11: 61,660,239	D32E	possibly damaging	Het
Grk2	C	A	19: 4,289,357	L428F	probably damaging	Het
Grm8	T	A	6: 27,363,179	E779V	probably damaging	Het
Hipk1	A	G	3: 103,754,296	S670P	probably damaging	Het
Itgae	A	T	11: 73,129,206	M845L	probably benign	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Itpka	T	A	2: 119,750,831	N448K	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc45	T	A	11: 120,718,193		probably null	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Meis1	G	A	11: 18,881,767	H424Y	possibly damaging	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr578	C	A	7: 102,984,836	L109F	possibly damaging	Het
Olfr875	T	C	9: 37,773,076	V139A	probably benign	Het
Otog	C	T	7: 46,269,362	T954I	possibly damaging	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Phlpp2	A	G	8: 109,937,106	T926A	probably damaging	Het
Plec	GGCAGCAG	GGCAGCAGCAG	15: 76,181,907		probably benign	Het
Plekha5	T	A	6: 140,589,634		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rasd1	A	T	11: 59,964,553	F85I	probably damaging	Het
Rgs1	A	T	1: 144,247,933	S85T	probably damaging	Het
Samd9l	T	C	6: 3,372,725	E1512G	possibly damaging	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Shc1	A	G	3: 89,422,969	D70G	probably damaging	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc26a7	A	T	4: 14,593,873	Y81N	probably damaging	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc30a7	T	A	3: 115,990,140		probably null	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Stard9	T	G	2: 120,696,999	S1246A	possibly damaging	Het
Stxbp5	A	T	10: 9,865,099	S116R	probably damaging	Het
Syvn1	C	T	19: 6,052,453	P517L	probably benign	Het
Tas2r105	T	C	6: 131,687,430	I12V	probably benign	Het
Tas2r121	A	G	6: 132,700,362	S216P	probably damaging	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tgm3	C	T	2: 130,026,682		probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Ucp3	T	A	7: 100,479,541	C25*	probably null	Het
Ugt3a2	A	G	15: 9,370,150	D460G	probably damaging	Het
Urb1	T	C	16: 90,795,448	D308G	possibly damaging	Het
Ush1g	G	T	11: 115,318,868	R167S	possibly damaging	Het
Vav3	A	G	3: 109,647,679	N81S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,459	D267E	probably benign	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107912798	splice site	probably null
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCAGCATGGCACTTCACGCTATC -3'
(R):5'- TGTCACCTACCTGCAATGGGACAC -3'

Sequencing Primer
(F):5'- CATTCCATGATGGACAAAGTACAGTG -3'
(R):5'- TGCAATGGGACACCATCCTTG -3'

Posted On

2013-10-16