Mutagenetix > Incidental Mutation

Incidental Mutation 'R0833:Stxbp5'

77651

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

039012-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0833 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9865099 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 116 (S116R)

Ref Sequence

ENSEMBL: ENSMUSP00000044535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

probably damaging
Transcript: ENSMUST00000038213
AA Change: S116R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: S116R

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000125200
AA Change: S116R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: S116R

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000141722
AA Change: S116R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: S116R

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Meta Mutation Damage Score

0.7959

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.6%

Validation Efficiency

100% (97/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	T	C	10: 87,165,069	L41P	probably damaging	Het
3110082I17Rik	A	G	5: 139,364,120	V58A	possibly damaging	Het
4932415M13Rik	A	T	17: 53,724,346		noncoding transcript	Het
Aldh1a7	C	T	19: 20,702,243	V390M	probably damaging	Het
Alg14	A	G	3: 121,298,610	H34R	probably damaging	Het
Ankrd27	A	G	7: 35,608,347	N337S	probably damaging	Het
Apoa2	T	A	1: 171,225,379		probably benign	Het
Arl2	T	G	19: 6,136,022	K126T	probably damaging	Het
Ascc3	T	C	10: 50,845,666	W2072R	probably benign	Het
Astl	T	C	2: 127,342,419	F21L	probably benign	Het
Asxl3	A	G	18: 22,516,040	D362G	probably damaging	Het
Bdp1	A	T	13: 100,035,825	H2094Q	probably benign	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cbwd1	A	G	19: 24,940,839		probably benign	Het
Ccdc144b	A	G	3: 36,020,213		probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd226	A	C	18: 89,207,020		probably benign	Het
Ces1f	A	T	8: 93,270,024	S214T	probably damaging	Het
Clip1	T	C	5: 123,630,721	D605G	probably benign	Het
Col26a1	A	G	5: 136,765,300		probably null	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
D17H6S53E	A	T	17: 35,127,409		probably null	Het
D17Wsu92e	A	T	17: 27,786,138	S148R	probably damaging	Het
Dnah11	G	A	12: 118,196,662	A111V	probably benign	Het
Dyrk2	T	C	10: 118,861,122	H77R	probably benign	Het
E330017A01Rik	G	A	16: 58,635,523	S129L	probably damaging	Het
Epha3	A	G	16: 63,603,519		probably benign	Het
Epn2	T	C	11: 61,519,491	N611S	probably benign	Het
Erich6	A	C	3: 58,618,944		probably benign	Het
Fam217b	T	C	2: 178,420,989	S249P	probably benign	Het
Fam219b	A	G	9: 57,538,016		probably benign	Het
Fryl	A	T	5: 73,089,081		probably benign	Het
Gm12800	G	A	4: 101,910,097	C181Y	probably damaging	Het
Gm13089	A	T	4: 143,698,486	M129K	probably benign	Het
Gm14496	T	C	2: 181,996,266	W378R	probably damaging	Het
Gm5155	C	A	7: 17,904,981	A301E	possibly damaging	Het
Gm8674	A	T	13: 49,904,575		noncoding transcript	Het
Grap	T	A	11: 61,660,239	D32E	possibly damaging	Het
Grk2	C	A	19: 4,289,357	L428F	probably damaging	Het
Grm8	T	A	6: 27,363,179	E779V	probably damaging	Het
Hipk1	A	G	3: 103,754,296	S670P	probably damaging	Het
Itgae	A	T	11: 73,129,206	M845L	probably benign	Het
Itih1	A	T	14: 30,941,555	V164E	probably damaging	Het
Itpka	T	A	2: 119,750,831	N448K	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Lrfn5	A	C	12: 61,839,668	T81P	probably damaging	Het
Lrrc45	T	A	11: 120,718,193		probably null	Het
March6	T	C	15: 31,480,291	Y562C	probably benign	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Meis1	G	A	11: 18,881,767	H424Y	possibly damaging	Het
Mst1r	G	A	9: 107,913,167	V660I	probably benign	Het
Mst1r	A	G	9: 107,914,776	N837S	probably benign	Het
Mthfd2l	T	C	5: 90,946,942	V90A	probably damaging	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Olfr1513	T	C	14: 52,349,378	I223V	probably benign	Het
Olfr578	C	A	7: 102,984,836	L109F	possibly damaging	Het
Olfr875	T	C	9: 37,773,076	V139A	probably benign	Het
Otog	C	T	7: 46,269,362	T954I	possibly damaging	Het
Pdcd6	A	G	13: 74,316,324		probably benign	Het
Phlpp2	A	G	8: 109,937,106	T926A	probably damaging	Het
Plec	GGCAGCAG	GGCAGCAGCAG	15: 76,181,907		probably benign	Het
Plekha5	T	A	6: 140,589,634		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rasd1	A	T	11: 59,964,553	F85I	probably damaging	Het
Rgs1	A	T	1: 144,247,933	S85T	probably damaging	Het
Samd9l	T	C	6: 3,372,725	E1512G	possibly damaging	Het
Sgsm1	C	T	5: 113,279,184	A127T	probably benign	Het
Shc1	A	G	3: 89,422,969	D70G	probably damaging	Het
Slc26a1	T	A	5: 108,673,523	T167S	probably benign	Het
Slc26a7	A	T	4: 14,593,873	Y81N	probably damaging	Het
Slc2a12	T	C	10: 22,702,016		probably benign	Het
Slc30a7	T	A	3: 115,990,140		probably null	Het
Slc44a5	T	C	3: 154,265,474	S654P	probably damaging	Het
Stard9	T	G	2: 120,696,999	S1246A	possibly damaging	Het
Syvn1	C	T	19: 6,052,453	P517L	probably benign	Het
Tas2r105	T	C	6: 131,687,430	I12V	probably benign	Het
Tas2r121	A	G	6: 132,700,362	S216P	probably damaging	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tgm3	C	T	2: 130,026,682		probably benign	Het
Tle2	T	C	10: 81,588,947	F667L	probably damaging	Het
Tnfaip3	C	A	10: 19,002,949	A704S	probably benign	Het
Trabd2b	A	G	4: 114,580,322	Q232R	probably benign	Het
Ttc28	T	A	5: 111,231,081	I1144N	probably damaging	Het
Ucp3	T	A	7: 100,479,541	C25*	probably null	Het
Ugt3a2	A	G	15: 9,370,150	D460G	probably damaging	Het
Urb1	T	C	16: 90,795,448	D308G	possibly damaging	Het
Ush1g	G	T	11: 115,318,868	R167S	possibly damaging	Het
Vav3	A	G	3: 109,647,679	N81S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,459	D267E	probably benign	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
R9172:Stxbp5	UTSW	10	9769408	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9843357	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9812010	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9899194	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CTCTGTGGGAAGGAAGAACTCTGTTG -3'
(R):5'- CCTGATGTTTAGAATTTGGGTGTGGCAA -3'

Sequencing Primer
(F):5'- GTATCCTCTGACACTGAAATTACTTC -3'
(R):5'- AGCAGCTATTTGGAAGCGTAA -3'

Posted On

2013-10-16