Mutagenetix > Incidental Mutations

Incidental Mutation 'R0834:Gnptab'

77738

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

039013-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.944) question?

Stock #

R0834 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88429952 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 409 (V409A)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020251
AA Change: V409A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: V409A

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132738

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141343

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Meta Mutation Damage Score

0.3234

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	T	C	16: 14,093,931	L47P	probably damaging	Het
Add2	A	T	6: 86,086,917	E66V	probably damaging	Het
Aldh1a3	T	C	7: 66,412,910	I156V	probably benign	Het
Ang4	T	A	14: 51,764,268	K74N	probably benign	Het
Arcn1	A	T	9: 44,758,875		probably benign	Het
Arhgef33	T	A	17: 80,347,597		probably benign	Het
Arntl2	A	G	6: 146,822,687	H359R	probably damaging	Het
Atn1	A	G	6: 124,743,225		probably benign	Het
Brip1	T	C	11: 86,192,827	T123A	probably benign	Het
Camkv	A	G	9: 107,945,846	Y95C	probably damaging	Het
Cdk12	T	A	11: 98,204,385	S340T	probably benign	Het
Ckap2l	G	A	2: 129,296,304		probably benign	Het
Clmn	A	T	12: 104,771,826	L1042Q	probably damaging	Het
Clmn	G	T	12: 104,771,827	L1042M	probably damaging	Het
Cluh	T	C	11: 74,663,805	V737A	probably benign	Het
Cpne8	A	G	15: 90,540,259	V309A	probably benign	Het
Cpxm2	T	A	7: 132,154,613		probably benign	Het
Csmd3	A	T	15: 47,883,677		probably benign	Het
Ctr9	T	A	7: 111,050,952	S818T	probably benign	Het
Cyp26a1	C	T	19: 37,699,957	A309V	probably damaging	Het
D10Jhu81e	T	C	10: 78,162,705	D229G	probably damaging	Het
Dbndd2	C	T	2: 164,490,202	T115I	possibly damaging	Het
Ddx58	T	A	4: 40,239,596	E34V	possibly damaging	Het
Dhcr7	A	G	7: 143,841,227	N157S	probably benign	Het
Dlx2	C	A	2: 71,545,515	V155F	probably damaging	Het
Duox1	A	T	2: 122,346,501	I1470F	probably damaging	Het
Esrrb	A	T	12: 86,470,297	I68F	probably benign	Het
Fhod3	T	A	18: 25,115,805	L1347*	probably null	Het
Fip1l1	T	C	5: 74,595,060		probably benign	Het
Frem3	A	G	8: 80,687,008	Y1966C	probably damaging	Het
Ggt5	C	T	10: 75,604,770	R242C	possibly damaging	Het
Gm14496	G	A	2: 181,995,687	V185I	probably benign	Het
Gramd1a	A	G	7: 31,138,164	F390S	possibly damaging	Het
Helz2	A	G	2: 181,230,777	S2477P	probably damaging	Het
Hsd17b3	T	C	13: 64,089,122	K3E	probably benign	Het
Ift172	T	C	5: 31,257,371	H1395R	probably benign	Het
Jam2	T	A	16: 84,812,967	C180S	probably damaging	Het
Kalrn	A	C	16: 34,049,919	S160A	possibly damaging	Het
Kcnk3	T	C	5: 30,622,635	I343T	probably damaging	Het
Kif13a	T	C	13: 46,814,236	E334G	probably damaging	Het
Klhl41	A	G	2: 69,678,147	K482E	possibly damaging	Het
Lig3	A	G	11: 82,798,287	E794G	probably damaging	Het
Myh13	T	C	11: 67,349,610	M780T	possibly damaging	Het
Ndst2	A	G	14: 20,729,693	Y160H	probably damaging	Het
Ndufb10	T	C	17: 24,722,674	M90V	probably damaging	Het
Obscn	T	C	11: 59,133,278	K522R	probably benign	Het
Olfml2b	T	C	1: 170,647,844	S113P	probably benign	Het
Olfr1251	A	G	2: 89,667,079	I269T	probably benign	Het
Olfr1424	T	A	19: 12,059,615	M46L	probably benign	Het
Olfr298	T	A	7: 86,489,490	E20D	probably benign	Het
Olfr420	T	A	1: 174,159,364	M197K	possibly damaging	Het
Olfr620	T	C	7: 103,612,237	T39A	probably benign	Het
Parg	T	C	14: 32,214,554		probably benign	Het
Pde7a	C	T	3: 19,230,318	C367Y	probably damaging	Het
Pigr	T	A	1: 130,844,544	C166*	probably null	Het
Pip4k2c	A	T	10: 127,200,835		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Prkd2	A	T	7: 16,865,677		probably benign	Het
Ptprt	G	T	2: 161,812,139		probably null	Het
Rapgef5	C	T	12: 117,647,121		probably benign	Het
Retreg1	T	C	15: 25,971,670	L356P	probably benign	Het
Rnf43	A	G	11: 87,731,251	T393A	probably benign	Het
Samd3	T	C	10: 26,271,827	S467P	probably benign	Het
Scarf1	C	A	11: 75,514,403	C89*	probably null	Het
Sdk1	T	C	5: 141,242,024	L59S	probably benign	Het
Sgca	C	T	11: 94,970,686	W244*	probably null	Het
Sh3d21	T	C	4: 126,151,272	K538R	probably benign	Het
Smyd4	T	A	11: 75,391,132	L477Q	possibly damaging	Het
Sra1	A	G	18: 36,668,776	M87T	probably benign	Het
Ssh2	T	C	11: 77,437,633	Y336H	possibly damaging	Het
Steap1	T	C	5: 5,740,357	Y197C	probably damaging	Het
Strn3	A	G	12: 51,627,096		probably benign	Het
Tgm3	A	G	2: 130,026,757	T205A	probably benign	Het
Tll2	G	A	19: 41,113,073	T374I	probably damaging	Het
Tmem63b	C	A	17: 45,660,944	D782Y	possibly damaging	Het
Trim10	G	A	17: 36,872,391	S193N	probably benign	Het
Ttf1	A	T	2: 29,073,950	K613*	probably null	Het
Tube1	T	A	10: 39,134,172		probably null	Het
Uimc1	T	A	13: 55,076,409		probably null	Het
Wwp2	G	T	8: 107,556,796		probably benign	Het
Zfp101	C	T	17: 33,382,444	V113I	probably benign	Het
Zfp292	T	C	4: 34,809,114	D1310G	probably benign	Het
Zfp575	A	T	7: 24,585,820	L132H	probably damaging	Het
Zmym2	T	C	14: 56,956,963	F1226S	probably damaging	Het
Zswim6	A	C	13: 107,726,454		noncoding transcript	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8313:Gnptab	UTSW	10	88439209	missense	probably damaging	1.00
R8351:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R8487:Gnptab	UTSW	10	88432646	critical splice donor site	probably null
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATCCTGGCTGAACCTTGACAAC -3'
(R):5'- ACCGCCTAACTGCTGACTTGGAAG -3'

Sequencing Primer
(F):5'- TCGAGTGACCATAGTGACCC -3'
(R):5'- CTTGGAAGTCAAAAATGCCTGC -3'

Posted On

2013-10-16