Incidental Mutation 'R0834:Kalrn'
ID77768
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 039013-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R0834 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34049919 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 160 (S160A)
Ref Sequence ENSEMBL: ENSMUSP00000110617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000114961] [ENSMUST00000114963] [ENSMUST00000114964] [ENSMUST00000114966] [ENSMUST00000114973] [ENSMUST00000232157]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076810
AA Change: S1829A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: S1829A

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114961
SMART Domains Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 40 179 2.22e-30 SMART
SPEC 193 309 5.32e-9 SMART
SPEC 315 417 1.19e-11 SMART
SPEC 420 535 1.83e0 SMART
SPEC 541 643 9.84e-13 SMART
SPEC 646 768 2.74e-2 SMART
SPEC 895 996 8.11e-14 SMART
SPEC 1126 1228 4.7e-10 SMART
RhoGEF 1278 1448 3.6e-56 SMART
PH 1462 1575 5.24e-8 SMART
SH3 1642 1703 1.23e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114963
SMART Domains Protein: ENSMUSP00000110614
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SH3 22 83 1.23e-7 SMART
RhoGEF 273 443 1.47e-52 SMART
PH 463 568 9.87e-4 SMART
SH3 664 725 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114964
SMART Domains Protein: ENSMUSP00000110615
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
RhoGEF 204 374 1.47e-52 SMART
PH 394 499 9.87e-4 SMART
SH3 595 656 2.78e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114966
AA Change: S160A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110617
Gene: ENSMUSG00000061751
AA Change: S160A

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114973
AA Change: S160A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110624
Gene: ENSMUSG00000061751
AA Change: S160A

DomainStartEndE-ValueType
RhoGEF 235 405 1.47e-52 SMART
PH 425 530 9.87e-4 SMART
SH3 626 687 2.78e-2 SMART
IGc2 786 858 4.28e-12 SMART
FN3 872 954 3.07e-11 SMART
S_TKc 987 1241 1.28e-71 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142817
AA Change: S1824A

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: S1824A

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232157
Meta Mutation Damage Score 0.0833 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T C 16: 14,093,931 L47P probably damaging Het
Add2 A T 6: 86,086,917 E66V probably damaging Het
Aldh1a3 T C 7: 66,412,910 I156V probably benign Het
Ang4 T A 14: 51,764,268 K74N probably benign Het
Arcn1 A T 9: 44,758,875 probably benign Het
Arhgef33 T A 17: 80,347,597 probably benign Het
Arntl2 A G 6: 146,822,687 H359R probably damaging Het
Atn1 A G 6: 124,743,225 probably benign Het
Brip1 T C 11: 86,192,827 T123A probably benign Het
Camkv A G 9: 107,945,846 Y95C probably damaging Het
Cdk12 T A 11: 98,204,385 S340T probably benign Het
Ckap2l G A 2: 129,296,304 probably benign Het
Clmn A T 12: 104,771,826 L1042Q probably damaging Het
Clmn G T 12: 104,771,827 L1042M probably damaging Het
Cluh T C 11: 74,663,805 V737A probably benign Het
Cpne8 A G 15: 90,540,259 V309A probably benign Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Csmd3 A T 15: 47,883,677 probably benign Het
Ctr9 T A 7: 111,050,952 S818T probably benign Het
Cyp26a1 C T 19: 37,699,957 A309V probably damaging Het
D10Jhu81e T C 10: 78,162,705 D229G probably damaging Het
Dbndd2 C T 2: 164,490,202 T115I possibly damaging Het
Ddx58 T A 4: 40,239,596 E34V possibly damaging Het
Dhcr7 A G 7: 143,841,227 N157S probably benign Het
Dlx2 C A 2: 71,545,515 V155F probably damaging Het
Duox1 A T 2: 122,346,501 I1470F probably damaging Het
Esrrb A T 12: 86,470,297 I68F probably benign Het
Fhod3 T A 18: 25,115,805 L1347* probably null Het
Fip1l1 T C 5: 74,595,060 probably benign Het
Frem3 A G 8: 80,687,008 Y1966C probably damaging Het
Ggt5 C T 10: 75,604,770 R242C possibly damaging Het
Gm14496 G A 2: 181,995,687 V185I probably benign Het
Gnptab T C 10: 88,429,952 V409A probably damaging Het
Gramd1a A G 7: 31,138,164 F390S possibly damaging Het
Helz2 A G 2: 181,230,777 S2477P probably damaging Het
Hsd17b3 T C 13: 64,089,122 K3E probably benign Het
Ift172 T C 5: 31,257,371 H1395R probably benign Het
Jam2 T A 16: 84,812,967 C180S probably damaging Het
Kcnk3 T C 5: 30,622,635 I343T probably damaging Het
Kif13a T C 13: 46,814,236 E334G probably damaging Het
Klhl41 A G 2: 69,678,147 K482E possibly damaging Het
Lig3 A G 11: 82,798,287 E794G probably damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Ndst2 A G 14: 20,729,693 Y160H probably damaging Het
Ndufb10 T C 17: 24,722,674 M90V probably damaging Het
Obscn T C 11: 59,133,278 K522R probably benign Het
Olfml2b T C 1: 170,647,844 S113P probably benign Het
Olfr1251 A G 2: 89,667,079 I269T probably benign Het
Olfr1424 T A 19: 12,059,615 M46L probably benign Het
Olfr298 T A 7: 86,489,490 E20D probably benign Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr620 T C 7: 103,612,237 T39A probably benign Het
Parg T C 14: 32,214,554 probably benign Het
Pde7a C T 3: 19,230,318 C367Y probably damaging Het
Pigr T A 1: 130,844,544 C166* probably null Het
Pip4k2c A T 10: 127,200,835 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkd2 A T 7: 16,865,677 probably benign Het
Ptprt G T 2: 161,812,139 probably null Het
Rapgef5 C T 12: 117,647,121 probably benign Het
Retreg1 T C 15: 25,971,670 L356P probably benign Het
Rnf43 A G 11: 87,731,251 T393A probably benign Het
Samd3 T C 10: 26,271,827 S467P probably benign Het
Scarf1 C A 11: 75,514,403 C89* probably null Het
Sdk1 T C 5: 141,242,024 L59S probably benign Het
Sgca C T 11: 94,970,686 W244* probably null Het
Sh3d21 T C 4: 126,151,272 K538R probably benign Het
Smyd4 T A 11: 75,391,132 L477Q possibly damaging Het
Sra1 A G 18: 36,668,776 M87T probably benign Het
Ssh2 T C 11: 77,437,633 Y336H possibly damaging Het
Steap1 T C 5: 5,740,357 Y197C probably damaging Het
Strn3 A G 12: 51,627,096 probably benign Het
Tgm3 A G 2: 130,026,757 T205A probably benign Het
Tll2 G A 19: 41,113,073 T374I probably damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Trim10 G A 17: 36,872,391 S193N probably benign Het
Ttf1 A T 2: 29,073,950 K613* probably null Het
Tube1 T A 10: 39,134,172 probably null Het
Uimc1 T A 13: 55,076,409 probably null Het
Wwp2 G T 8: 107,556,796 probably benign Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp292 T C 4: 34,809,114 D1310G probably benign Het
Zfp575 A T 7: 24,585,820 L132H probably damaging Het
Zmym2 T C 14: 56,956,963 F1226S probably damaging Het
Zswim6 A C 13: 107,726,454 noncoding transcript Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
Hidden UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACACTAAAGGCCCTGCTGGTTTC -3'
(R):5'- TGGTAACTGACCAGAGTCCCTCAC -3'

Sequencing Primer
(F):5'- CCTATGCCAATTTCCACATAAAGATG -3'
(R):5'- AGAGTCCCTCACAAGGGATCTG -3'
Posted On2013-10-16