Mutagenetix > Incidental Mutations

Incidental Mutation 'R0834:Tll2'

77779

Institutional Source

Beutler Lab

Gene Symbol

Tll2

Ensembl Gene

ENSMUSG00000025013

Gene Name

tolloid-like 2

Synonyms

MMRRC Submission

039013-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.874) question?

Stock #

R0834 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41083981-41206774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 41113073 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 374 (T374I)

Ref Sequence

ENSEMBL: ENSMUSP00000125973 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025986] [ENSMUST00000169941]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025986
AA Change: T391I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000025986
Gene: ENSMUSG00000025013
AA Change: T391I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
ZnMc	152	294	1.15e-54	SMART
CUB	348	460	7.69e-44	SMART
CUB	461	573	8.69e-52	SMART
EGF_CA	573	614	1.26e-11	SMART
CUB	617	729	3.99e-51	SMART
EGF_CA	729	769	5.92e-8	SMART
CUB	773	885	3.08e-43	SMART
CUB	886	1002	2.25e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169941
AA Change: T374I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125973
Gene: ENSMUSG00000025013
AA Change: T374I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
ZnMc	152	294	1.15e-54	SMART
CUB	331	443	7.69e-44	SMART
CUB	444	556	8.69e-52	SMART
EGF_CA	556	597	1.26e-11	SMART
CUB	600	712	3.99e-51	SMART
EGF_CA	712	752	5.92e-8	SMART
CUB	756	868	3.08e-43	SMART
CUB	869	985	2.25e-36	SMART

Meta Mutation Damage Score

0.8626

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased muscle weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	T	C	16: 14,093,931	L47P	probably damaging	Het
Add2	A	T	6: 86,086,917	E66V	probably damaging	Het
Aldh1a3	T	C	7: 66,412,910	I156V	probably benign	Het
Ang4	T	A	14: 51,764,268	K74N	probably benign	Het
Arcn1	A	T	9: 44,758,875		probably benign	Het
Arhgef33	T	A	17: 80,347,597		probably benign	Het
Arntl2	A	G	6: 146,822,687	H359R	probably damaging	Het
Atn1	A	G	6: 124,743,225		probably benign	Het
Brip1	T	C	11: 86,192,827	T123A	probably benign	Het
Camkv	A	G	9: 107,945,846	Y95C	probably damaging	Het
Cdk12	T	A	11: 98,204,385	S340T	probably benign	Het
Ckap2l	G	A	2: 129,296,304		probably benign	Het
Clmn	A	T	12: 104,771,826	L1042Q	probably damaging	Het
Clmn	G	T	12: 104,771,827	L1042M	probably damaging	Het
Cluh	T	C	11: 74,663,805	V737A	probably benign	Het
Cpne8	A	G	15: 90,540,259	V309A	probably benign	Het
Cpxm2	T	A	7: 132,154,613		probably benign	Het
Csmd3	A	T	15: 47,883,677		probably benign	Het
Ctr9	T	A	7: 111,050,952	S818T	probably benign	Het
Cyp26a1	C	T	19: 37,699,957	A309V	probably damaging	Het
D10Jhu81e	T	C	10: 78,162,705	D229G	probably damaging	Het
Dbndd2	C	T	2: 164,490,202	T115I	possibly damaging	Het
Ddx58	T	A	4: 40,239,596	E34V	possibly damaging	Het
Dhcr7	A	G	7: 143,841,227	N157S	probably benign	Het
Dlx2	C	A	2: 71,545,515	V155F	probably damaging	Het
Duox1	A	T	2: 122,346,501	I1470F	probably damaging	Het
Esrrb	A	T	12: 86,470,297	I68F	probably benign	Het
Fhod3	T	A	18: 25,115,805	L1347*	probably null	Het
Fip1l1	T	C	5: 74,595,060		probably benign	Het
Frem3	A	G	8: 80,687,008	Y1966C	probably damaging	Het
Ggt5	C	T	10: 75,604,770	R242C	possibly damaging	Het
Gm14496	G	A	2: 181,995,687	V185I	probably benign	Het
Gnptab	T	C	10: 88,429,952	V409A	probably damaging	Het
Gramd1a	A	G	7: 31,138,164	F390S	possibly damaging	Het
Helz2	A	G	2: 181,230,777	S2477P	probably damaging	Het
Hsd17b3	T	C	13: 64,089,122	K3E	probably benign	Het
Ift172	T	C	5: 31,257,371	H1395R	probably benign	Het
Jam2	T	A	16: 84,812,967	C180S	probably damaging	Het
Kalrn	A	C	16: 34,049,919	S160A	possibly damaging	Het
Kcnk3	T	C	5: 30,622,635	I343T	probably damaging	Het
Kif13a	T	C	13: 46,814,236	E334G	probably damaging	Het
Klhl41	A	G	2: 69,678,147	K482E	possibly damaging	Het
Lig3	A	G	11: 82,798,287	E794G	probably damaging	Het
Myh13	T	C	11: 67,349,610	M780T	possibly damaging	Het
Ndst2	A	G	14: 20,729,693	Y160H	probably damaging	Het
Ndufb10	T	C	17: 24,722,674	M90V	probably damaging	Het
Obscn	T	C	11: 59,133,278	K522R	probably benign	Het
Olfml2b	T	C	1: 170,647,844	S113P	probably benign	Het
Olfr1251	A	G	2: 89,667,079	I269T	probably benign	Het
Olfr1424	T	A	19: 12,059,615	M46L	probably benign	Het
Olfr298	T	A	7: 86,489,490	E20D	probably benign	Het
Olfr420	T	A	1: 174,159,364	M197K	possibly damaging	Het
Olfr620	T	C	7: 103,612,237	T39A	probably benign	Het
Parg	T	C	14: 32,214,554		probably benign	Het
Pde7a	C	T	3: 19,230,318	C367Y	probably damaging	Het
Pigr	T	A	1: 130,844,544	C166*	probably null	Het
Pip4k2c	A	T	10: 127,200,835		probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Prkd2	A	T	7: 16,865,677		probably benign	Het
Ptprt	G	T	2: 161,812,139		probably null	Het
Rapgef5	C	T	12: 117,647,121		probably benign	Het
Retreg1	T	C	15: 25,971,670	L356P	probably benign	Het
Rnf43	A	G	11: 87,731,251	T393A	probably benign	Het
Samd3	T	C	10: 26,271,827	S467P	probably benign	Het
Scarf1	C	A	11: 75,514,403	C89*	probably null	Het
Sdk1	T	C	5: 141,242,024	L59S	probably benign	Het
Sgca	C	T	11: 94,970,686	W244*	probably null	Het
Sh3d21	T	C	4: 126,151,272	K538R	probably benign	Het
Smyd4	T	A	11: 75,391,132	L477Q	possibly damaging	Het
Sra1	A	G	18: 36,668,776	M87T	probably benign	Het
Ssh2	T	C	11: 77,437,633	Y336H	possibly damaging	Het
Steap1	T	C	5: 5,740,357	Y197C	probably damaging	Het
Strn3	A	G	12: 51,627,096		probably benign	Het
Tgm3	A	G	2: 130,026,757	T205A	probably benign	Het
Tmem63b	C	A	17: 45,660,944	D782Y	possibly damaging	Het
Trim10	G	A	17: 36,872,391	S193N	probably benign	Het
Ttf1	A	T	2: 29,073,950	K613*	probably null	Het
Tube1	T	A	10: 39,134,172		probably null	Het
Uimc1	T	A	13: 55,076,409		probably null	Het
Wwp2	G	T	8: 107,556,796		probably benign	Het
Zfp101	C	T	17: 33,382,444	V113I	probably benign	Het
Zfp292	T	C	4: 34,809,114	D1310G	probably benign	Het
Zfp575	A	T	7: 24,585,820	L132H	probably damaging	Het
Zmym2	T	C	14: 56,956,963	F1226S	probably damaging	Het
Zswim6	A	C	13: 107,726,454		noncoding transcript	Het

Other mutations in Tll2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01555:Tll2	APN	19	41086366	missense	probably benign	0.01
IGL02028:Tll2	APN	19	41098649	nonsense	probably null
IGL02146:Tll2	APN	19	41097837	missense	probably benign	0.00
IGL02192:Tll2	APN	19	41086263	missense	possibly damaging	0.73
IGL02544:Tll2	APN	19	41135965	missense	probably damaging	1.00
PIT4677001:Tll2	UTSW	19	41130558	missense	probably benign	0.14
R0141:Tll2	UTSW	19	41097912	missense	probably damaging	1.00
R0372:Tll2	UTSW	19	41183313	critical splice acceptor site	probably null
R0393:Tll2	UTSW	19	41088826	missense	possibly damaging	0.95
R0402:Tll2	UTSW	19	41098693	missense	possibly damaging	0.56
R0613:Tll2	UTSW	19	41104990	missense	probably damaging	0.97
R0756:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R0757:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R0790:Tll2	UTSW	19	41103850	missense	probably damaging	0.98
R0843:Tll2	UTSW	19	41128463	splice site	probably null
R1014:Tll2	UTSW	19	41103851	missense	probably damaging	1.00
R1178:Tll2	UTSW	19	41092847	missense	probably damaging	1.00
R1233:Tll2	UTSW	19	41095984	missense	possibly damaging	0.79
R1364:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R1367:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R1368:Tll2	UTSW	19	41120228	missense	probably damaging	1.00
R1519:Tll2	UTSW	19	41086400	missense	probably benign	0.17
R1894:Tll2	UTSW	19	41088671	critical splice donor site	probably null
R1896:Tll2	UTSW	19	41113059	missense	probably benign	0.44
R1917:Tll2	UTSW	19	41128497	missense	possibly damaging	0.83
R2170:Tll2	UTSW	19	41183275	missense	probably damaging	1.00
R4433:Tll2	UTSW	19	41121348	missense	probably benign	0.03
R4617:Tll2	UTSW	19	41098636	missense	probably benign	0.31
R4831:Tll2	UTSW	19	41130512	missense	probably damaging	1.00
R5057:Tll2	UTSW	19	41117266	missense	probably benign	0.02
R5119:Tll2	UTSW	19	41130509	missense	possibly damaging	0.48
R5194:Tll2	UTSW	19	41095897	missense	probably damaging	1.00
R5280:Tll2	UTSW	19	41117257	missense	possibly damaging	0.87
R5602:Tll2	UTSW	19	41104981	missense	possibly damaging	0.63
R5800:Tll2	UTSW	19	41104934	missense	probably benign	0.10
R6223:Tll2	UTSW	19	41135952	missense	possibly damaging	0.54
R7047:Tll2	UTSW	19	41086240	missense	probably damaging	0.99
R7155:Tll2	UTSW	19	41117284	missense	possibly damaging	0.72
R7213:Tll2	UTSW	19	41120227	missense	probably damaging	0.97
R7231:Tll2	UTSW	19	41086234	missense	probably benign	0.02
R7390:Tll2	UTSW	19	41120169	critical splice donor site	probably null
R7414:Tll2	UTSW	19	41103829	missense	probably damaging	0.98
R7757:Tll2	UTSW	19	41096008	missense	probably damaging	1.00
R8165:Tll2	UTSW	19	41088874	missense	possibly damaging	0.79
R8418:Tll2	UTSW	19	41092837	missense	probably damaging	1.00
X0027:Tll2	UTSW	19	41183303	missense	probably damaging	1.00
Z1177:Tll2	UTSW	19	41092734	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- ACGGAACCTTCCAGATAGGGAGAAC -3'
(R):5'- GATGCACTTGAGCTAACCCCAGAC -3'

Sequencing Primer
(F):5'- TTCCAGATAGGGAGAACACACTC -3'
(R):5'- GATGATGTTCCAAGATCCTTTCG -3'

Posted On

2013-10-16