Incidental Mutation 'R0835:Olfr1206'
ID77788
Institutional Source Beutler Lab
Gene Symbol Olfr1206
Ensembl Gene ENSMUSG00000062757
Gene Nameolfactory receptor 1206
SynonymsOlfr1207, GA_x6K02T2Q125-50338497-50339264, MOR230-3, GA_x6K02T2Q125-50339974-50340609
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88863231-88867753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88865001 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 132 (V132A)
Ref Sequence ENSEMBL: ENSMUSP00000149929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077302] [ENSMUST00000216950]
Predicted Effect probably benign
Transcript: ENSMUST00000077302
AA Change: V132A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076532
Gene: ENSMUSG00000062757
AA Change: V132A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216950
AA Change: V132A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Olfr1206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Olfr1206 APN 2 88865520 missense probably benign 0.00
IGL01415:Olfr1206 APN 2 88865520 missense probably benign 0.00
IGL01783:Olfr1206 APN 2 88864842 missense probably damaging 0.98
PIT4812001:Olfr1206 UTSW 2 88864970 missense probably benign 0.27
R0437:Olfr1206 UTSW 2 88864885 missense probably benign 0.01
R0561:Olfr1206 UTSW 2 88864680 missense possibly damaging 0.68
R0669:Olfr1206 UTSW 2 88864928 missense probably benign
R0987:Olfr1206 UTSW 2 88865183 missense probably benign 0.00
R1271:Olfr1206 UTSW 2 88865131 nonsense probably null
R1386:Olfr1206 UTSW 2 88865353 missense probably benign 0.14
R1618:Olfr1206 UTSW 2 88865527 synonymous probably null
R1935:Olfr1206 UTSW 2 88865180 missense probably benign
R2098:Olfr1206 UTSW 2 88864871 missense probably benign 0.43
R2112:Olfr1206 UTSW 2 88865201 missense possibly damaging 0.67
R2157:Olfr1206 UTSW 2 88864869 missense probably benign
R2912:Olfr1206 UTSW 2 88865114 missense probably benign 0.17
R2913:Olfr1206 UTSW 2 88865114 missense probably benign 0.17
R4583:Olfr1206 UTSW 2 88865494 missense probably benign 0.07
R4631:Olfr1206 UTSW 2 88864830 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGACTCATTGTGGATGCCCTC -3'
(R):5'- ACTGTGGTTTCGCAGAGAGTGTAAG -3'

Sequencing Primer
(F):5'- TGTGGATGCCCTCTCTAAAAAG -3'
(R):5'- TTGAGCAAATGGCACCACTG -3'
Posted On2013-10-16