Incidental Mutation 'R0835:Aoc1'
ID77814
Institutional Source Beutler Lab
Gene Symbol Aoc1
Ensembl Gene ENSMUSG00000029811
Gene Nameamine oxidase, copper-containing 1
SynonymsAbp1, 1600012D06Rik
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48872896-48909188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48905514 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 130 (F130S)
Ref Sequence ENSEMBL: ENSMUSP00000144764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031835] [ENSMUST00000162948] [ENSMUST00000167529] [ENSMUST00000204856]
Predicted Effect probably damaging
Transcript: ENSMUST00000031835
AA Change: F108S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031835
Gene: ENSMUSG00000029811
AA Change: F108S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161184
Predicted Effect probably damaging
Transcript: ENSMUST00000162948
AA Change: F108S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124085
Gene: ENSMUSG00000029811
AA Change: F108S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167529
AA Change: F108S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128816
Gene: ENSMUSG00000029811
AA Change: F108S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 2.4e-30 PFAM
Pfam:Cu_amine_oxidN3 146 246 1.5e-23 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 717 1.5e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204856
AA Change: F130S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144764
Gene: ENSMUSG00000029811
AA Change: F130S

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 4.3e-28 PFAM
Pfam:Cu_amine_oxidN3 168 250 8.9e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metal-binding membrane glycoprotein that oxidatively deaminates putrescine, histamine, and related compounds. The encoded protein is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Aoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Aoc1 APN 6 48908664 missense possibly damaging 0.92
IGL01115:Aoc1 APN 6 48906197 missense probably damaging 1.00
IGL01626:Aoc1 APN 6 48906531 missense probably damaging 1.00
IGL01891:Aoc1 APN 6 48908842 unclassified probably benign
IGL01908:Aoc1 APN 6 48906756 missense probably damaging 1.00
IGL01919:Aoc1 APN 6 48908289 missense probably damaging 1.00
IGL01960:Aoc1 APN 6 48908603 missense probably benign 0.00
IGL02102:Aoc1 APN 6 48905962 missense probably damaging 0.99
IGL02121:Aoc1 APN 6 48906320 unclassified probably null
IGL02229:Aoc1 APN 6 48905909 nonsense probably null
IGL02325:Aoc1 APN 6 48905895 missense possibly damaging 0.46
IGL02626:Aoc1 APN 6 48906110 missense probably benign 0.04
IGL02737:Aoc1 APN 6 48907643 missense probably benign 0.01
IGL03244:Aoc1 APN 6 48905822 missense possibly damaging 0.79
IGL03371:Aoc1 APN 6 48906446 missense probably benign 0.05
R0100:Aoc1 UTSW 6 48908604 missense possibly damaging 0.92
R1240:Aoc1 UTSW 6 48905615 missense probably benign 0.10
R1400:Aoc1 UTSW 6 48906283 nonsense probably null
R1400:Aoc1 UTSW 6 48906711 missense probably benign
R1443:Aoc1 UTSW 6 48905445 missense possibly damaging 0.95
R1447:Aoc1 UTSW 6 48906242 missense probably benign 0.00
R1572:Aoc1 UTSW 6 48905786 missense possibly damaging 0.48
R1850:Aoc1 UTSW 6 48905268 missense probably benign 0.19
R2008:Aoc1 UTSW 6 48905897 missense probably damaging 1.00
R2256:Aoc1 UTSW 6 48906440 missense possibly damaging 0.95
R3429:Aoc1 UTSW 6 48906076 missense probably benign
R3430:Aoc1 UTSW 6 48906076 missense probably benign
R3432:Aoc1 UTSW 6 48905844 missense probably damaging 1.00
R3783:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3786:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3787:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R4024:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4025:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4455:Aoc1 UTSW 6 48905467 missense probably damaging 0.98
R4510:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4511:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4525:Aoc1 UTSW 6 48906675 missense probably damaging 1.00
R4659:Aoc1 UTSW 6 48906076 missense probably benign
R4876:Aoc1 UTSW 6 48906747 missense possibly damaging 0.78
R5150:Aoc1 UTSW 6 48906150 missense possibly damaging 0.88
R5153:Aoc1 UTSW 6 48908747 missense probably benign 0.19
R5437:Aoc1 UTSW 6 48907750 missense probably benign 0.00
R6000:Aoc1 UTSW 6 48907639 missense probably benign 0.05
R6112:Aoc1 UTSW 6 48908691 missense probably damaging 1.00
R6195:Aoc1 UTSW 6 48908677 missense probably damaging 1.00
R6252:Aoc1 UTSW 6 48906081 missense probably benign 0.01
R6703:Aoc1 UTSW 6 48905714 missense probably damaging 1.00
R6748:Aoc1 UTSW 6 48906294 missense possibly damaging 0.84
R6765:Aoc1 UTSW 6 48905937 missense probably benign 0.00
R6935:Aoc1 UTSW 6 48908227 missense probably damaging 1.00
R7002:Aoc1 UTSW 6 48905876 missense probably benign
R7066:Aoc1 UTSW 6 48908619 missense probably damaging 1.00
R7120:Aoc1 UTSW 6 48906597 missense probably damaging 1.00
R7234:Aoc1 UTSW 6 48905816 nonsense probably null
R7362:Aoc1 UTSW 6 48905411 missense probably benign 0.18
R7452:Aoc1 UTSW 6 48908790 missense probably benign 0.11
X0066:Aoc1 UTSW 6 48908252 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCTGGAGTCATCCAAGAATC -3'
(R):5'- CGGCGCTACATCCGTAAAAGTCAAG -3'

Sequencing Primer
(F):5'- CATCCAAGAATCTGACTTTGGC -3'
(R):5'- CTAGGAATGAGAAGCCAGTAGTGTC -3'
Posted On2013-10-16