Incidental Mutation 'R0835:1700034J05Rik'
ID77820
Institutional Source Beutler Lab
Gene Symbol 1700034J05Rik
Ensembl Gene ENSMUSG00000040163
Gene NameRIKEN cDNA 1700034J05 gene
Synonyms
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location146950329-146954422 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 146953538 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000036592] [ENSMUST00000111622] [ENSMUST00000111623] [ENSMUST00000203730]
Predicted Effect probably benign
Transcript: ENSMUST00000016631
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000036592
AA Change: T2K
SMART Domains Protein: ENSMUSP00000043802
Gene: ENSMUSG00000040163
AA Change: T2K

DomainStartEndE-ValueType
Pfam:DUF4640 18 301 2.7e-128 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000111622
AA Change: T2K
SMART Domains Protein: ENSMUSP00000107249
Gene: ENSMUSG00000040163
AA Change: T2K

DomainStartEndE-ValueType
Pfam:DUF4640 18 300 1.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111623
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203730
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in 1700034J05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:1700034J05Rik APN 6 146953340 missense probably damaging 1.00
IGL01725:1700034J05Rik APN 6 146952269 missense probably damaging 0.97
IGL01860:1700034J05Rik APN 6 146952416 missense possibly damaging 0.77
IGL01991:1700034J05Rik APN 6 146953110 missense probably benign 0.32
IGL02375:1700034J05Rik APN 6 146953315 missense possibly damaging 0.92
R0254:1700034J05Rik UTSW 6 146952404 missense probably benign 0.00
R0361:1700034J05Rik UTSW 6 146952371 missense possibly damaging 0.94
R1101:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1428:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1487:1700034J05Rik UTSW 6 146953379 missense probably benign 0.16
R1887:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1988:1700034J05Rik UTSW 6 146952896 missense possibly damaging 0.70
R1989:1700034J05Rik UTSW 6 146952896 missense possibly damaging 0.70
R4063:1700034J05Rik UTSW 6 146953108 missense probably benign 0.32
R6122:1700034J05Rik UTSW 6 146952252 makesense probably null
R6578:1700034J05Rik UTSW 6 146953314 nonsense probably null
R7029:1700034J05Rik UTSW 6 146952343 missense probably benign 0.00
X0066:1700034J05Rik UTSW 6 146953540 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CAAAGAATCCACAGAGGCTGTCTCC -3'
(R):5'- ACCTTGACCTCAGAAGAGTGGACTG -3'

Sequencing Primer
(F):5'- AGAGGCTGTCTCCTCACG -3'
(R):5'- GTGGACTGAAAACATACTTGACTC -3'
Posted On2013-10-16