Mutagenetix > Incidental Mutations

Incidental Mutation 'R0835:Syt9'

77825

Institutional Source

Beutler Lab

Gene Symbol

Syt9

Ensembl Gene

ENSMUSG00000062542

Gene Name

synaptotagmin IX

Synonyms

Sytv

MMRRC Submission

039014-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0835 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107370728-107548656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107506530 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 460 (N460S)

Ref Sequence

ENSEMBL: ENSMUSP00000073164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073459] [ENSMUST00000130414]

Predicted Effect

probably benign
Transcript: ENSMUST00000073459
AA Change: N460S

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000073164
Gene: ENSMUSG00000062542
AA Change: N460S

Domain	Start	End	E-Value	Type
low complexity region	37	49	N/A	INTRINSIC
Blast:C2	53	166	7e-54	BLAST
C2	236	339	1.8e-26	SMART
C2	368	482	1.6e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127444

Predicted Effect

probably benign
Transcript: ENSMUST00000130414

SMART Domains

Protein: ENSMUSP00000122049
Gene: ENSMUSG00000062542

Domain	Start	End	E-Value	Type
low complexity region	37	49	N/A	INTRINSIC
Blast:C2	53	166	3e-57	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144003

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.2%
20x: 90.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit 50% embryonic lethality while cre-mediated removal of a conditional allele impairs inhibitions of postsynaptic currents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	G	T	6: 146,953,538		probably benign	Het
Abca16	A	G	7: 120,465,784	T555A	probably benign	Het
Abca4	A	T	3: 122,126,213	D1048V	probably damaging	Het
Abcf2	G	T	5: 24,574,253	T99N	probably damaging	Het
Acan	A	T	7: 79,114,232	S2119C	probably damaging	Het
Adgre4	G	A	17: 55,799,637	C292Y	probably damaging	Het
Alk	A	G	17: 71,869,842	F1489S	probably damaging	Het
Ampd2	A	G	3: 108,076,502	V573A	possibly damaging	Het
Aoc1	T	C	6: 48,905,514	F130S	probably damaging	Het
Bbs2	A	T	8: 94,075,259	I554N	probably damaging	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cbfa2t3	T	C	8: 122,647,778	H76R	probably benign	Het
Cdc14a	G	T	3: 116,328,522	N216K	probably benign	Het
Cep126	T	C	9: 8,130,223	Y69C	probably damaging	Het
Cep135	A	T	5: 76,615,706	R514S	probably benign	Het
Cfi	A	T	3: 129,868,542	Y390F	probably damaging	Het
Chd8	T	C	14: 52,204,025	D870G	probably benign	Het
Clptm1	A	G	7: 19,635,674	V437A	possibly damaging	Het
Coro2b	T	C	9: 62,425,837	N422S	possibly damaging	Het
Coro7	T	C	16: 4,632,254	E577G	probably benign	Het
Crh	G	A	3: 19,694,364	P38L	probably benign	Het
Ctif	T	A	18: 75,435,336	D577V	probably damaging	Het
Deup1	T	A	9: 15,599,751	Q244L	probably damaging	Het
Dhx16	A	G	17: 35,881,689	E171G	probably damaging	Het
Dnah11	A	C	12: 117,916,788	Y3866D	probably damaging	Het
Dync1i2	C	T	2: 71,250,972	L508F	probably damaging	Het
Dync2h1	T	A	9: 7,116,642		probably null	Het
E2f4	C	T	8: 105,300,508	Q235*	probably null	Het
Eif2b3	A	G	4: 117,058,805	H203R	probably damaging	Het
Epha5	A	T	5: 84,386,242	W77R	probably damaging	Het
Gpx6	C	T	13: 21,317,068	P109S	probably damaging	Het
Gsdmc4	A	T	15: 63,893,800	V300E	probably damaging	Het
Gspt1	A	C	16: 11,238,938	S198A	probably benign	Het
Itpk1	C	T	12: 102,675,448	V39M	probably damaging	Het
Kremen2	G	T	17: 23,742,837	P232Q	probably damaging	Het
Lamtor4	C	A	5: 138,259,058	T74K	probably benign	Het
Mbtd1	T	A	11: 93,931,839	F492I	probably benign	Het
Mroh1	G	T	15: 76,451,883	V1486F	probably damaging	Het
Myg1	G	A	15: 102,332,102	V76M	probably damaging	Het
Myo16	G	T	8: 10,272,766	Q65H	probably damaging	Het
Ncapg	A	G	5: 45,681,448	E487G	probably damaging	Het
Ncoa5	T	C	2: 165,002,794	E332G	probably damaging	Het
Nek6	T	A	2: 38,569,631	I162N	possibly damaging	Het
Nwd2	C	A	5: 63,800,130	R268S	probably damaging	Het
Olfr1206	T	C	2: 88,865,001	V132A	probably benign	Het
Olfr461	T	C	6: 40,544,338	I214V	probably benign	Het
Palm3	T	G	8: 84,028,147	S141A	probably benign	Het
Pbrm1	T	C	14: 31,067,579	F728L	probably damaging	Het
Phf3	A	G	1: 30,830,551	V472A	probably benign	Het
Plekha5	T	A	6: 140,568,850	L35*	probably null	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Ppp6r2	G	A	15: 89,268,582	E309K	possibly damaging	Het
Ptpn6	T	A	6: 124,727,536		probably null	Het
Rasgrf1	T	C	9: 90,000,771	V882A	probably benign	Het
Ryr3	T	G	2: 112,650,138	E4335D	probably benign	Het
Slc12a5	T	A	2: 164,994,038	I892N	probably damaging	Het
Slc22a2	G	A	17: 12,612,431	M369I	probably benign	Het
Sox10	A	T	15: 79,156,441	Y300N	probably damaging	Het
Speg	T	C	1: 75,375,674	F79L	probably benign	Het
Sult1b1	T	A	5: 87,517,452	I208L	probably benign	Het
Tecpr1	T	A	5: 144,212,592	N339I	possibly damaging	Het
Tmem63b	C	A	17: 45,660,944	D782Y	possibly damaging	Het
Ttc30a2	T	C	2: 75,978,150	N6S	probably benign	Het
Ttn	T	C	2: 76,894,761		probably benign	Het
Upk3bl	G	T	5: 136,057,331	R40S	probably benign	Het
Usp28	T	C	9: 49,001,524	I25T	probably damaging	Het
Vmn2r27	A	G	6: 124,200,624	Y474H	probably damaging	Het
Vps13a	A	T	19: 16,734,882		probably null	Het
Wdr36	A	T	18: 32,849,082	N371I	possibly damaging	Het
Wnt7b	A	G	15: 85,537,777	F228S	probably damaging	Het
Xirp2	T	C	2: 67,507,910	I165T	possibly damaging	Het
Zan	T	G	5: 137,408,397		probably benign	Het
Zfp760	A	G	17: 21,723,578	D578G	possibly damaging	Het
Zfyve19	T	A	2: 119,210,785	S61T	probably benign	Het
Zfyve9	T	C	4: 108,718,669	D405G	probably damaging	Het

Other mutations in Syt9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Syt9	APN	7	107425367	nonsense	probably null
IGL00541:Syt9	APN	7	107502180	missense	probably null	1.00
IGL01161:Syt9	APN	7	107425149	missense	probably damaging	0.97
IGL01705:Syt9	APN	7	107436352	missense	probably damaging	0.96
IGL02567:Syt9	APN	7	107436661	missense	probably damaging	1.00
IGL03268:Syt9	APN	7	107436405	missense	probably benign	0.01
R0684:Syt9	UTSW	7	107425136	missense	probably damaging	1.00
R0743:Syt9	UTSW	7	107436561	missense	probably damaging	0.97
R0884:Syt9	UTSW	7	107436561	missense	probably damaging	0.97
R1114:Syt9	UTSW	7	107425355	missense	possibly damaging	0.93
R1502:Syt9	UTSW	7	107436487	missense	probably damaging	1.00
R1885:Syt9	UTSW	7	107436529	missense	probably damaging	1.00
R1962:Syt9	UTSW	7	107425107	missense	probably damaging	1.00
R2368:Syt9	UTSW	7	107436699	missense	probably damaging	1.00
R2421:Syt9	UTSW	7	107436781	missense	probably benign	0.39
R4134:Syt9	UTSW	7	107436423	missense	probably benign	0.22
R4477:Syt9	UTSW	7	107425221	missense	probably damaging	1.00
R4602:Syt9	UTSW	7	107436387	nonsense	probably null
R4685:Syt9	UTSW	7	107436471	missense	possibly damaging	0.89
R4977:Syt9	UTSW	7	107504272	missense	probably damaging	1.00
R5141:Syt9	UTSW	7	107504219	missense	probably damaging	1.00
R5421:Syt9	UTSW	7	107425356	missense	probably benign	0.00
R5440:Syt9	UTSW	7	107502123	missense	possibly damaging	0.46
R5633:Syt9	UTSW	7	107425296	missense	probably damaging	1.00
R5978:Syt9	UTSW	7	107436413	missense	probably benign	0.02
R6260:Syt9	UTSW	7	107436510	missense	possibly damaging	0.93
R6733:Syt9	UTSW	7	107425296	missense	probably damaging	1.00
R6889:Syt9	UTSW	7	107425286	missense	probably damaging	0.99
R7572:Syt9	UTSW	7	107436577	missense	probably damaging	1.00
R8080:Syt9	UTSW	7	107436790	missense	probably benign
X0018:Syt9	UTSW	7	107506574	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- GAACTTCCTCCACCCATCTGAGTTG -3'
(R):5'- GGGATAGAAGAGCCTGGCACATTTG -3'

Sequencing Primer
(F):5'- cggtgaccccaaccataag -3'
(R):5'- GGCACATTTGTGCTGTTCAC -3'

Posted On

2013-10-16