Incidental Mutation 'R0835:Itpk1'
ID77842
Institutional Source Beutler Lab
Gene Symbol Itpk1
Ensembl Gene ENSMUSG00000057963
Gene Nameinositol 1,3,4-triphosphate 5/6 kinase
Synonyms
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R0835 (G1)
Quality Score104
Status Not validated
Chromosome12
Chromosomal Location102568582-102704930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102675448 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 39 (V39M)
Ref Sequence ENSEMBL: ENSMUSP00000137275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046518] [ENSMUST00000178697] [ENSMUST00000179210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046518
AA Change: V39M

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046027
Gene: ENSMUSG00000057963
AA Change: V39M

DomainStartEndE-ValueType
Pfam:Ins134_P3_kin 1 318 2.8e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178129
Predicted Effect probably damaging
Transcript: ENSMUST00000178697
AA Change: V39M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137275
Gene: ENSMUSG00000057963
AA Change: V39M

DomainStartEndE-ValueType
Pfam:Ins134_P3_kin 1 48 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179210
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the inositol 1,3,4-trisphosphate 5/6-kinase family. This enzyme regulates the synthesis of inositol tetraphosphate, and downstream products, inositol pentakisphosphate and inositol hexakisphosphate. Inositol metabolism plays a role in the development of the neural tube. Disruptions in this gene are thought to be associated with neural tube defects. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mice homozygous for a gene trap allele exhibit neural tube defects (exencephaly and spina bifida), growth retardation, kyphoscoliosis, and rib formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dhx16 A G 17: 35,881,689 E171G probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Itpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Itpk1 APN 12 102606103 missense probably damaging 1.00
IGL02247:Itpk1 APN 12 102623409 missense probably damaging 1.00
IGL02998:Itpk1 APN 12 102579139 missense probably damaging 1.00
ANU23:Itpk1 UTSW 12 102606103 missense probably damaging 1.00
R0432:Itpk1 UTSW 12 102606078 splice site probably benign
R0622:Itpk1 UTSW 12 102573980 missense probably damaging 1.00
R0659:Itpk1 UTSW 12 102606078 splice site probably benign
R1171:Itpk1 UTSW 12 102606119 missense probably damaging 1.00
R1812:Itpk1 UTSW 12 102574058 missense probably benign 0.01
R1968:Itpk1 UTSW 12 102675470 splice site probably null
R2277:Itpk1 UTSW 12 102570260 missense probably benign
R2926:Itpk1 UTSW 12 102579130 missense probably damaging 1.00
R4584:Itpk1 UTSW 12 102570157 missense possibly damaging 0.89
R4690:Itpk1 UTSW 12 102606175 missense probably damaging 0.96
R5050:Itpk1 UTSW 12 102704810 missense probably damaging 1.00
R5326:Itpk1 UTSW 12 102573966 missense possibly damaging 0.49
R5801:Itpk1 UTSW 12 102573945 missense probably damaging 1.00
R5945:Itpk1 UTSW 12 102588553 missense probably damaging 0.97
R7262:Itpk1 UTSW 12 102675453 missense possibly damaging 0.89
R7421:Itpk1 UTSW 12 102574065 missense possibly damaging 0.92
X0058:Itpk1 UTSW 12 102574024 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAGCTATGTCAGATCTCCAGGC -3'
(R):5'- CCAGAAACCAGGACAGAGTGTTCAG -3'

Sequencing Primer
(F):5'- CGAGGGGGAGTATCACAATCC -3'
(R):5'- ATAGTTGCTGCCAGCTCTACAG -3'
Posted On2013-10-16