Mutagenetix > Incidental Mutations

Incidental Mutation 'R0835:Chd8'

77846

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

039014-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0835 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52204025 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 870 (D870G)

Ref Sequence

ENSEMBL: ENSMUSP00000122995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]

Predicted Effect

probably benign
Transcript: ENSMUST00000089752
AA Change: D2210G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: D2210G

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147309

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147827

Predicted Effect

probably benign
Transcript: ENSMUST00000149975
AA Change: D870G

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: D870G

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180857

Predicted Effect

probably benign
Transcript: ENSMUST00000200169
AA Change: D2210G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: D2210G

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227448

Predicted Effect

probably benign
Transcript: ENSMUST00000227897

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.2%
20x: 90.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	G	T	6: 146,953,538		probably benign	Het
Abca16	A	G	7: 120,465,784	T555A	probably benign	Het
Abca4	A	T	3: 122,126,213	D1048V	probably damaging	Het
Abcf2	G	T	5: 24,574,253	T99N	probably damaging	Het
Acan	A	T	7: 79,114,232	S2119C	probably damaging	Het
Adgre4	G	A	17: 55,799,637	C292Y	probably damaging	Het
Alk	A	G	17: 71,869,842	F1489S	probably damaging	Het
Ampd2	A	G	3: 108,076,502	V573A	possibly damaging	Het
Aoc1	T	C	6: 48,905,514	F130S	probably damaging	Het
Bbs2	A	T	8: 94,075,259	I554N	probably damaging	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cbfa2t3	T	C	8: 122,647,778	H76R	probably benign	Het
Cdc14a	G	T	3: 116,328,522	N216K	probably benign	Het
Cep126	T	C	9: 8,130,223	Y69C	probably damaging	Het
Cep135	A	T	5: 76,615,706	R514S	probably benign	Het
Cfi	A	T	3: 129,868,542	Y390F	probably damaging	Het
Clptm1	A	G	7: 19,635,674	V437A	possibly damaging	Het
Coro2b	T	C	9: 62,425,837	N422S	possibly damaging	Het
Coro7	T	C	16: 4,632,254	E577G	probably benign	Het
Crh	G	A	3: 19,694,364	P38L	probably benign	Het
Ctif	T	A	18: 75,435,336	D577V	probably damaging	Het
Deup1	T	A	9: 15,599,751	Q244L	probably damaging	Het
Dhx16	A	G	17: 35,881,689	E171G	probably damaging	Het
Dnah11	A	C	12: 117,916,788	Y3866D	probably damaging	Het
Dync1i2	C	T	2: 71,250,972	L508F	probably damaging	Het
Dync2h1	T	A	9: 7,116,642		probably null	Het
E2f4	C	T	8: 105,300,508	Q235*	probably null	Het
Eif2b3	A	G	4: 117,058,805	H203R	probably damaging	Het
Epha5	A	T	5: 84,386,242	W77R	probably damaging	Het
Gpx6	C	T	13: 21,317,068	P109S	probably damaging	Het
Gsdmc4	A	T	15: 63,893,800	V300E	probably damaging	Het
Gspt1	A	C	16: 11,238,938	S198A	probably benign	Het
Itpk1	C	T	12: 102,675,448	V39M	probably damaging	Het
Kremen2	G	T	17: 23,742,837	P232Q	probably damaging	Het
Lamtor4	C	A	5: 138,259,058	T74K	probably benign	Het
Mbtd1	T	A	11: 93,931,839	F492I	probably benign	Het
Mroh1	G	T	15: 76,451,883	V1486F	probably damaging	Het
Myg1	G	A	15: 102,332,102	V76M	probably damaging	Het
Myo16	G	T	8: 10,272,766	Q65H	probably damaging	Het
Ncapg	A	G	5: 45,681,448	E487G	probably damaging	Het
Ncoa5	T	C	2: 165,002,794	E332G	probably damaging	Het
Nek6	T	A	2: 38,569,631	I162N	possibly damaging	Het
Nwd2	C	A	5: 63,800,130	R268S	probably damaging	Het
Olfr1206	T	C	2: 88,865,001	V132A	probably benign	Het
Olfr461	T	C	6: 40,544,338	I214V	probably benign	Het
Palm3	T	G	8: 84,028,147	S141A	probably benign	Het
Pbrm1	T	C	14: 31,067,579	F728L	probably damaging	Het
Phf3	A	G	1: 30,830,551	V472A	probably benign	Het
Plekha5	T	A	6: 140,568,850	L35*	probably null	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Ppp6r2	G	A	15: 89,268,582	E309K	possibly damaging	Het
Ptpn6	T	A	6: 124,727,536		probably null	Het
Rasgrf1	T	C	9: 90,000,771	V882A	probably benign	Het
Ryr3	T	G	2: 112,650,138	E4335D	probably benign	Het
Slc12a5	T	A	2: 164,994,038	I892N	probably damaging	Het
Slc22a2	G	A	17: 12,612,431	M369I	probably benign	Het
Sox10	A	T	15: 79,156,441	Y300N	probably damaging	Het
Speg	T	C	1: 75,375,674	F79L	probably benign	Het
Sult1b1	T	A	5: 87,517,452	I208L	probably benign	Het
Syt9	A	G	7: 107,506,530	N460S	probably benign	Het
Tecpr1	T	A	5: 144,212,592	N339I	possibly damaging	Het
Tmem63b	C	A	17: 45,660,944	D782Y	possibly damaging	Het
Ttc30a2	T	C	2: 75,978,150	N6S	probably benign	Het
Ttn	T	C	2: 76,894,761		probably benign	Het
Upk3bl	G	T	5: 136,057,331	R40S	probably benign	Het
Usp28	T	C	9: 49,001,524	I25T	probably damaging	Het
Vmn2r27	A	G	6: 124,200,624	Y474H	probably damaging	Het
Vps13a	A	T	19: 16,734,882		probably null	Het
Wdr36	A	T	18: 32,849,082	N371I	possibly damaging	Het
Wnt7b	A	G	15: 85,537,777	F228S	probably damaging	Het
Xirp2	T	C	2: 67,507,910	I165T	possibly damaging	Het
Zan	T	G	5: 137,408,397		probably benign	Het
Zfp760	A	G	17: 21,723,578	D578G	possibly damaging	Het
Zfyve19	T	A	2: 119,210,785	S61T	probably benign	Het
Zfyve9	T	C	4: 108,718,669	D405G	probably damaging	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52227506	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTTTAGTGATCCACATGCCTCG -3'
(R):5'- CGTGTTCTGATAAACCGCATTGACC -3'

Sequencing Primer
(F):5'- cacatgcctcggccttc -3'
(R):5'- GATAAACCGCATTGACCTCGTC -3'

Posted On

2013-10-16