Incidental Mutation 'R0835:Dhx16'
ID77863
Institutional Source Beutler Lab
Gene Symbol Dhx16
Ensembl Gene ENSMUSG00000024422
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 16
SynonymsDdx16, DBP2, 2410006N22Rik
MMRRC Submission 039014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0835 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35879819-35892670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35881689 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 171 (E171G)
Ref Sequence ENSEMBL: ENSMUSP00000133888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025292] [ENSMUST00000174366]
Predicted Effect probably damaging
Transcript: ENSMUST00000025292
AA Change: E171G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025292
Gene: ENSMUSG00000024422
AA Change: E171G

DomainStartEndE-ValueType
Blast:DEXDc 55 310 6e-57 BLAST
DEXDc 400 585 7.26e-33 SMART
HELICc 636 733 1.7e-15 SMART
HA2 794 885 2.24e-31 SMART
Pfam:OB_NTP_bind 901 1018 3.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174366
AA Change: E171G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133888
Gene: ENSMUSG00000024422
AA Change: E171G

DomainStartEndE-ValueType
Blast:DEXDc 55 310 9e-58 BLAST
DEXDc 400 585 7.26e-33 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik G T 6: 146,953,538 probably benign Het
Abca16 A G 7: 120,465,784 T555A probably benign Het
Abca4 A T 3: 122,126,213 D1048V probably damaging Het
Abcf2 G T 5: 24,574,253 T99N probably damaging Het
Acan A T 7: 79,114,232 S2119C probably damaging Het
Adgre4 G A 17: 55,799,637 C292Y probably damaging Het
Alk A G 17: 71,869,842 F1489S probably damaging Het
Ampd2 A G 3: 108,076,502 V573A possibly damaging Het
Aoc1 T C 6: 48,905,514 F130S probably damaging Het
Bbs2 A T 8: 94,075,259 I554N probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbfa2t3 T C 8: 122,647,778 H76R probably benign Het
Cdc14a G T 3: 116,328,522 N216K probably benign Het
Cep126 T C 9: 8,130,223 Y69C probably damaging Het
Cep135 A T 5: 76,615,706 R514S probably benign Het
Cfi A T 3: 129,868,542 Y390F probably damaging Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Clptm1 A G 7: 19,635,674 V437A possibly damaging Het
Coro2b T C 9: 62,425,837 N422S possibly damaging Het
Coro7 T C 16: 4,632,254 E577G probably benign Het
Crh G A 3: 19,694,364 P38L probably benign Het
Ctif T A 18: 75,435,336 D577V probably damaging Het
Deup1 T A 9: 15,599,751 Q244L probably damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dync1i2 C T 2: 71,250,972 L508F probably damaging Het
Dync2h1 T A 9: 7,116,642 probably null Het
E2f4 C T 8: 105,300,508 Q235* probably null Het
Eif2b3 A G 4: 117,058,805 H203R probably damaging Het
Epha5 A T 5: 84,386,242 W77R probably damaging Het
Gpx6 C T 13: 21,317,068 P109S probably damaging Het
Gsdmc4 A T 15: 63,893,800 V300E probably damaging Het
Gspt1 A C 16: 11,238,938 S198A probably benign Het
Itpk1 C T 12: 102,675,448 V39M probably damaging Het
Kremen2 G T 17: 23,742,837 P232Q probably damaging Het
Lamtor4 C A 5: 138,259,058 T74K probably benign Het
Mbtd1 T A 11: 93,931,839 F492I probably benign Het
Mroh1 G T 15: 76,451,883 V1486F probably damaging Het
Myg1 G A 15: 102,332,102 V76M probably damaging Het
Myo16 G T 8: 10,272,766 Q65H probably damaging Het
Ncapg A G 5: 45,681,448 E487G probably damaging Het
Ncoa5 T C 2: 165,002,794 E332G probably damaging Het
Nek6 T A 2: 38,569,631 I162N possibly damaging Het
Nwd2 C A 5: 63,800,130 R268S probably damaging Het
Olfr1206 T C 2: 88,865,001 V132A probably benign Het
Olfr461 T C 6: 40,544,338 I214V probably benign Het
Palm3 T G 8: 84,028,147 S141A probably benign Het
Pbrm1 T C 14: 31,067,579 F728L probably damaging Het
Phf3 A G 1: 30,830,551 V472A probably benign Het
Plekha5 T A 6: 140,568,850 L35* probably null Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp6r2 G A 15: 89,268,582 E309K possibly damaging Het
Ptpn6 T A 6: 124,727,536 probably null Het
Rasgrf1 T C 9: 90,000,771 V882A probably benign Het
Ryr3 T G 2: 112,650,138 E4335D probably benign Het
Slc12a5 T A 2: 164,994,038 I892N probably damaging Het
Slc22a2 G A 17: 12,612,431 M369I probably benign Het
Sox10 A T 15: 79,156,441 Y300N probably damaging Het
Speg T C 1: 75,375,674 F79L probably benign Het
Sult1b1 T A 5: 87,517,452 I208L probably benign Het
Syt9 A G 7: 107,506,530 N460S probably benign Het
Tecpr1 T A 5: 144,212,592 N339I possibly damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Ttc30a2 T C 2: 75,978,150 N6S probably benign Het
Ttn T C 2: 76,894,761 probably benign Het
Upk3bl G T 5: 136,057,331 R40S probably benign Het
Usp28 T C 9: 49,001,524 I25T probably damaging Het
Vmn2r27 A G 6: 124,200,624 Y474H probably damaging Het
Vps13a A T 19: 16,734,882 probably null Het
Wdr36 A T 18: 32,849,082 N371I possibly damaging Het
Wnt7b A G 15: 85,537,777 F228S probably damaging Het
Xirp2 T C 2: 67,507,910 I165T possibly damaging Het
Zan T G 5: 137,408,397 probably benign Het
Zfp760 A G 17: 21,723,578 D578G possibly damaging Het
Zfyve19 T A 2: 119,210,785 S61T probably benign Het
Zfyve9 T C 4: 108,718,669 D405G probably damaging Het
Other mutations in Dhx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dhx16 APN 17 35887934 missense probably benign 0.02
IGL01533:Dhx16 APN 17 35882047 missense probably damaging 1.00
IGL01743:Dhx16 APN 17 35888108 missense probably damaging 1.00
IGL01946:Dhx16 APN 17 35885504 missense probably benign 0.01
IGL02170:Dhx16 APN 17 35889469 missense probably damaging 1.00
IGL02327:Dhx16 APN 17 35883825 missense probably benign 0.00
IGL02334:Dhx16 APN 17 35884057 missense probably damaging 1.00
IGL02417:Dhx16 APN 17 35892537 missense probably damaging 1.00
R0403:Dhx16 UTSW 17 35883050 critical splice donor site probably null
R0410:Dhx16 UTSW 17 35890967 missense probably damaging 1.00
R0544:Dhx16 UTSW 17 35881659 missense probably benign 0.35
R0845:Dhx16 UTSW 17 35883302 missense probably damaging 1.00
R1642:Dhx16 UTSW 17 35891065 missense probably damaging 1.00
R1833:Dhx16 UTSW 17 35885619 missense probably benign 0.36
R1905:Dhx16 UTSW 17 35888355 missense probably benign
R2233:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R2234:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R4647:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4648:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4665:Dhx16 UTSW 17 35879943 missense probably damaging 1.00
R4674:Dhx16 UTSW 17 35885939 missense probably damaging 1.00
R4862:Dhx16 UTSW 17 35883262 missense probably benign 0.34
R5089:Dhx16 UTSW 17 35884089 missense probably damaging 1.00
R5122:Dhx16 UTSW 17 35883310 missense probably damaging 1.00
R5665:Dhx16 UTSW 17 35891086 nonsense probably null
R5748:Dhx16 UTSW 17 35883314 missense probably damaging 1.00
R5763:Dhx16 UTSW 17 35881688 missense possibly damaging 0.87
R5956:Dhx16 UTSW 17 35882870 missense probably damaging 0.96
R6001:Dhx16 UTSW 17 35883874 missense probably damaging 1.00
R6216:Dhx16 UTSW 17 35882972 missense possibly damaging 0.49
R6420:Dhx16 UTSW 17 35883014 missense possibly damaging 0.92
R6467:Dhx16 UTSW 17 35886184 missense probably damaging 1.00
R7326:Dhx16 UTSW 17 35886160 missense probably damaging 1.00
R7338:Dhx16 UTSW 17 35888144 missense probably damaging 1.00
R7457:Dhx16 UTSW 17 35891060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCAGGAGCTGTCATATCTACCG -3'
(R):5'- TGCAGCCAAATCCAGACTTGCC -3'

Sequencing Primer
(F):5'- aggacgaggaggacgag -3'
(R):5'- AATCCAGACTTGCCTGACTG -3'
Posted On2013-10-16