Incidental Mutation 'R0836:Itpka'
ID 77879
Institutional Source Beutler Lab
Gene Symbol Itpka
Ensembl Gene ENSMUSG00000027296
Gene Name inositol 1,4,5-trisphosphate 3-kinase A
Synonyms IP3-kinase A
MMRRC Submission 039015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R0836 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 119572818-119581734 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119581312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 448 (N448K)
Ref Sequence ENSEMBL: ENSMUSP00000028758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028758] [ENSMUST00000028759] [ENSMUST00000082130] [ENSMUST00000140224] [ENSMUST00000182203]
AlphaFold Q8R071
Predicted Effect probably damaging
Transcript: ENSMUST00000028758
AA Change: N448K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028758
Gene: ENSMUSG00000027296
AA Change: N448K

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 116 149 N/A INTRINSIC
Pfam:IPK 243 454 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028759
SMART Domains Protein: ENSMUSP00000028759
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 111 381 2.4e-21 PFAM
transmembrane domain 423 445 N/A INTRINSIC
TyrKc 506 773 2.61e-127 SMART
low complexity region 824 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082130
SMART Domains Protein: ENSMUSP00000080774
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 109 294 6.1e-16 PFAM
transmembrane domain 362 384 N/A INTRINSIC
TyrKc 445 712 2.61e-127 SMART
low complexity region 763 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134295
Predicted Effect probably benign
Transcript: ENSMUST00000140224
SMART Domains Protein: ENSMUSP00000123020
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 1.2e-129 SMART
low complexity region 512 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182203
SMART Domains Protein: ENSMUSP00000138201
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
TyrKc 194 461 2.61e-127 SMART
low complexity region 512 529 N/A INTRINSIC
Meta Mutation Damage Score 0.8038 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of the inositol 1,4,5-trisphosphate 3-kinase is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. It is also a substrate for the cyclic AMP-dependent protein kinase, calcium/calmodulin- dependent protein kinase II, and protein kinase C in vitro.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display enhanced long term potentiation in the hippocampal CA1 region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aldh9a1 G A 1: 167,177,824 (GRCm39) G7D probably benign Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Asphd2 A T 5: 112,539,635 (GRCm39) L66H probably damaging Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Bptf C A 11: 107,001,638 (GRCm39) probably null Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cadps2 T C 6: 23,328,775 (GRCm39) probably benign Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Cfap43 C A 19: 47,804,285 (GRCm39) V304L probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Cpa5 T C 6: 30,623,210 (GRCm39) S124P probably damaging Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fezf1 T C 6: 23,246,998 (GRCm39) H278R probably benign Het
Fhod3 T A 18: 25,199,275 (GRCm39) Y649N probably damaging Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itga2 A G 13: 114,993,215 (GRCm39) V800A probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Kcnd2 T A 6: 21,727,328 (GRCm39) V627E probably damaging Het
Kcnd2 T C 6: 21,726,238 (GRCm39) probably benign Het
Ktn1 A G 14: 47,938,519 (GRCm39) probably null Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Macf1 A G 4: 123,388,675 (GRCm39) probably null Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Nfkbia C A 12: 55,537,561 (GRCm39) A211S probably damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or56b1b T C 7: 108,164,205 (GRCm39) T266A possibly damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Otog C T 7: 45,918,786 (GRCm39) T954I possibly damaging Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Pmch A G 10: 87,927,086 (GRCm39) I30V probably benign Het
Ppat A C 5: 77,070,348 (GRCm39) Y157D probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Rbp3 T G 14: 33,678,595 (GRCm39) S848A possibly damaging Het
Rgs1 A T 1: 144,123,671 (GRCm39) S85T probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc34a2 A G 5: 53,225,049 (GRCm39) T397A probably benign Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Sorcs3 G A 19: 48,475,833 (GRCm39) V231I probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tax1bp1 C T 6: 52,718,925 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Tgm3 C T 2: 129,868,602 (GRCm39) probably benign Het
Thbs4 T G 13: 92,894,546 (GRCm39) D659A probably damaging Het
Tmed11 A T 5: 108,943,175 (GRCm39) M1K probably null Het
Tmpo A T 10: 90,997,815 (GRCm39) C657* probably null Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r108 A T 17: 20,691,721 (GRCm39) D267E probably benign Het
Vmn2r17 A T 5: 109,575,822 (GRCm39) H231L possibly damaging Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Itpka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Itpka APN 2 119,573,254 (GRCm39) missense probably benign
IGL02998:Itpka APN 2 119,581,242 (GRCm39) missense possibly damaging 0.91
R0833:Itpka UTSW 2 119,581,312 (GRCm39) missense probably damaging 1.00
R4032:Itpka UTSW 2 119,573,082 (GRCm39) missense probably benign 0.20
R5207:Itpka UTSW 2 119,580,974 (GRCm39) missense probably damaging 1.00
R6520:Itpka UTSW 2 119,581,259 (GRCm39) missense probably benign 0.15
R7900:Itpka UTSW 2 119,580,994 (GRCm39) missense probably benign 0.14
R8409:Itpka UTSW 2 119,580,341 (GRCm39) missense probably damaging 1.00
R8430:Itpka UTSW 2 119,580,035 (GRCm39) missense probably damaging 1.00
R9008:Itpka UTSW 2 119,579,894 (GRCm39) missense probably damaging 0.99
R9239:Itpka UTSW 2 119,580,023 (GRCm39) missense probably damaging 1.00
Z1176:Itpka UTSW 2 119,573,281 (GRCm39) missense probably damaging 0.97
Z1177:Itpka UTSW 2 119,581,256 (GRCm39) missense probably damaging 1.00
Z1177:Itpka UTSW 2 119,579,902 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTAAGAGTCAGTAACGCCGCCC -3'
(R):5'- AGGCAACTCCTGATGTACTACACCC -3'

Sequencing Primer
(F):5'- CGCCCTTGGTGTGAAATTAATC -3'
(R):5'- ACTACACCCCCTTAGTGGATGG -3'
Posted On 2013-10-16