Incidental Mutation 'R0836:Tgm3'
ID 77882
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Name transglutaminase 3, E polypeptide
Synonyms we, TG E
MMRRC Submission 039015-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0836 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 129854269-129892319 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 129868602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
AlphaFold Q08189
Predicted Effect probably benign
Transcript: ENSMUST00000110299
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aldh9a1 G A 1: 167,177,824 (GRCm39) G7D probably benign Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Asphd2 A T 5: 112,539,635 (GRCm39) L66H probably damaging Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Bptf C A 11: 107,001,638 (GRCm39) probably null Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cadps2 T C 6: 23,328,775 (GRCm39) probably benign Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Cfap43 C A 19: 47,804,285 (GRCm39) V304L probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Cpa5 T C 6: 30,623,210 (GRCm39) S124P probably damaging Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fezf1 T C 6: 23,246,998 (GRCm39) H278R probably benign Het
Fhod3 T A 18: 25,199,275 (GRCm39) Y649N probably damaging Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itga2 A G 13: 114,993,215 (GRCm39) V800A probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Itpka T A 2: 119,581,312 (GRCm39) N448K probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Kcnd2 T A 6: 21,727,328 (GRCm39) V627E probably damaging Het
Kcnd2 T C 6: 21,726,238 (GRCm39) probably benign Het
Ktn1 A G 14: 47,938,519 (GRCm39) probably null Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Macf1 A G 4: 123,388,675 (GRCm39) probably null Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Nfkbia C A 12: 55,537,561 (GRCm39) A211S probably damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or56b1b T C 7: 108,164,205 (GRCm39) T266A possibly damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Otog C T 7: 45,918,786 (GRCm39) T954I possibly damaging Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Pmch A G 10: 87,927,086 (GRCm39) I30V probably benign Het
Ppat A C 5: 77,070,348 (GRCm39) Y157D probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Rbp3 T G 14: 33,678,595 (GRCm39) S848A possibly damaging Het
Rgs1 A T 1: 144,123,671 (GRCm39) S85T probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc34a2 A G 5: 53,225,049 (GRCm39) T397A probably benign Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Sorcs3 G A 19: 48,475,833 (GRCm39) V231I probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tax1bp1 C T 6: 52,718,925 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Thbs4 T G 13: 92,894,546 (GRCm39) D659A probably damaging Het
Tmed11 A T 5: 108,943,175 (GRCm39) M1K probably null Het
Tmpo A T 10: 90,997,815 (GRCm39) C657* probably null Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r108 A T 17: 20,691,721 (GRCm39) D267E probably benign Het
Vmn2r17 A T 5: 109,575,822 (GRCm39) H231L possibly damaging Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 129,880,333 (GRCm39) missense probably damaging 1.00
IGL00924:Tgm3 APN 2 129,880,294 (GRCm39) missense probably damaging 1.00
IGL01469:Tgm3 APN 2 129,866,414 (GRCm39) missense probably damaging 1.00
IGL01722:Tgm3 APN 2 129,886,488 (GRCm39) missense probably damaging 0.99
IGL01787:Tgm3 APN 2 129,889,660 (GRCm39) missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 129,866,438 (GRCm39) missense probably benign 0.02
IGL02437:Tgm3 APN 2 129,871,961 (GRCm39) splice site probably null
IGL02449:Tgm3 APN 2 129,880,529 (GRCm39) critical splice donor site probably null
IGL02992:Tgm3 APN 2 129,883,899 (GRCm39) missense probably damaging 1.00
tortellini UTSW 2 129,866,505 (GRCm39) critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 129,890,310 (GRCm39) missense probably damaging 1.00
R0523:Tgm3 UTSW 2 129,886,582 (GRCm39) critical splice donor site probably null
R0833:Tgm3 UTSW 2 129,868,602 (GRCm39) splice site probably benign
R0834:Tgm3 UTSW 2 129,868,677 (GRCm39) missense probably benign 0.00
R0940:Tgm3 UTSW 2 129,854,326 (GRCm39) missense probably benign 0.00
R1354:Tgm3 UTSW 2 129,883,818 (GRCm39) missense probably benign
R1642:Tgm3 UTSW 2 129,889,702 (GRCm39) missense probably damaging 1.00
R1670:Tgm3 UTSW 2 129,883,688 (GRCm39) nonsense probably null
R1715:Tgm3 UTSW 2 129,868,734 (GRCm39) critical splice donor site probably null
R1944:Tgm3 UTSW 2 129,871,889 (GRCm39) missense probably damaging 0.99
R2104:Tgm3 UTSW 2 129,879,403 (GRCm39) missense probably benign 0.39
R3416:Tgm3 UTSW 2 129,889,692 (GRCm39) missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 129,889,692 (GRCm39) missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 129,886,509 (GRCm39) nonsense probably null
R4296:Tgm3 UTSW 2 129,880,333 (GRCm39) missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 129,883,875 (GRCm39) missense probably benign 0.00
R4948:Tgm3 UTSW 2 129,890,240 (GRCm39) missense probably benign 0.00
R5034:Tgm3 UTSW 2 129,879,404 (GRCm39) missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 129,890,202 (GRCm39) missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 129,868,704 (GRCm39) nonsense probably null
R6030:Tgm3 UTSW 2 129,883,920 (GRCm39) missense probably damaging 1.00
R6030:Tgm3 UTSW 2 129,883,920 (GRCm39) missense probably damaging 1.00
R6182:Tgm3 UTSW 2 129,867,221 (GRCm39) nonsense probably null
R6219:Tgm3 UTSW 2 129,880,530 (GRCm39) critical splice donor site probably null
R6901:Tgm3 UTSW 2 129,883,890 (GRCm39) missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 129,883,949 (GRCm39) missense probably benign 0.06
R6980:Tgm3 UTSW 2 129,868,697 (GRCm39) missense probably benign 0.17
R7282:Tgm3 UTSW 2 129,866,481 (GRCm39) missense probably benign 0.00
R7317:Tgm3 UTSW 2 129,890,211 (GRCm39) missense probably benign 0.09
R7513:Tgm3 UTSW 2 129,866,324 (GRCm39) missense probably benign 0.00
R7517:Tgm3 UTSW 2 129,883,684 (GRCm39) missense probably benign 0.01
R7793:Tgm3 UTSW 2 129,854,330 (GRCm39) critical splice donor site probably null
R7822:Tgm3 UTSW 2 129,883,819 (GRCm39) missense probably benign 0.00
R7955:Tgm3 UTSW 2 129,880,400 (GRCm39) missense probably benign
R8747:Tgm3 UTSW 2 129,886,452 (GRCm39) missense probably benign 0.03
R8805:Tgm3 UTSW 2 129,889,702 (GRCm39) missense probably damaging 1.00
R8987:Tgm3 UTSW 2 129,880,403 (GRCm39) missense probably benign 0.00
R9029:Tgm3 UTSW 2 129,871,680 (GRCm39) missense probably benign 0.00
R9208:Tgm3 UTSW 2 129,865,618 (GRCm39) missense possibly damaging 0.76
R9423:Tgm3 UTSW 2 129,880,527 (GRCm39) missense probably benign 0.01
R9713:Tgm3 UTSW 2 129,867,229 (GRCm39) missense possibly damaging 0.74
X0065:Tgm3 UTSW 2 129,866,430 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGAGTGGACTGCAATGTGCC -3'
(R):5'- TGATGGAGCAGAACTTCTCCTCCC -3'

Sequencing Primer
(F):5'- GGACTGCAATGTGCCATCTC -3'
(R):5'- attggcaaaatgggcaagg -3'
Posted On 2013-10-16