Incidental Mutation 'R0836:Shc1'
ID77885
Institutional Source Beutler Lab
Gene Symbol Shc1
Ensembl Gene ENSMUSG00000042626
Gene Namesrc homology 2 domain-containing transforming protein C1
SynonymsShcA, p66shc, p66
MMRRC Submission 039015-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0836 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89418443-89430027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89422969 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000123635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029679] [ENSMUST00000039110] [ENSMUST00000094378] [ENSMUST00000107417] [ENSMUST00000107422] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000154791] [ENSMUST00000183484] [ENSMUST00000191485]
AlphaFold P98083
Predicted Effect probably benign
Transcript: ENSMUST00000029679
SMART Domains Protein: ENSMUSP00000029679
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
CKS 5 74 4.1e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039110
AA Change: D70G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626
AA Change: D70G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094378
AA Change: D180G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626
AA Change: D180G

DomainStartEndE-ValueType
low complexity region 16 55 N/A INTRINSIC
low complexity region 85 98 N/A INTRINSIC
low complexity region 116 127 N/A INTRINSIC
PTB 157 321 2.15e-31 SMART
SH2 482 561 1.71e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107417
AA Change: D25G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626
AA Change: D25G

DomainStartEndE-ValueType
PTB 2 166 2.15e-31 SMART
SH2 327 406 1.71e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107422
SMART Domains Protein: ENSMUSP00000103045
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
CKS 1 52 3.88e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125036
AA Change: D14G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626
AA Change: D14G

DomainStartEndE-ValueType
PTB 1 155 1.5e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128238
AA Change: D70G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626
AA Change: D70G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 144 7.7e-19 PFAM
Pfam:PID 134 190 7.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137793
AA Change: D70G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626
AA Change: D70G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153334
Predicted Effect probably damaging
Transcript: ENSMUST00000154791
AA Change: D70G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626
AA Change: D70G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:PID 52 100 5.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183484
SMART Domains Protein: ENSMUSP00000138900
Gene: ENSMUSG00000028044

DomainStartEndE-ValueType
Pfam:CKS 5 36 2.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191485
AA Change: D70G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626
AA Change: D70G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
PTB 47 211 2.15e-31 SMART
SH2 372 451 1.71e-26 SMART
Meta Mutation Damage Score 0.6897 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes with a targeted mutation of the exon encoding the CH2 region show an extended life span, reduced cellular sensitivity to oxidative stress and UV irradiation, and resistance to diet-induced atherogenesis. Homozygotes lacking all three isoformsdie around E11.5 with cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
A930003A15Rik T C 16: 19,883,872 noncoding transcript Het
Abca8a A T 11: 110,040,564 D1253E possibly damaging Het
Acsm3 T C 7: 119,777,100 I350T possibly damaging Het
Adcy9 T C 16: 4,419,271 D92G possibly damaging Het
Aldh9a1 G A 1: 167,350,255 G7D probably benign Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Asphd2 A T 5: 112,391,769 L66H probably damaging Het
Astl T C 2: 127,342,419 F21L probably benign Het
Bptf C A 11: 107,110,812 probably null Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cadps2 T C 6: 23,328,776 probably benign Het
Camk4 G T 18: 32,939,454 S20I unknown Het
Ccdc36 A T 9: 108,404,801 C563S probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd209e G T 8: 3,853,205 D62E probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Cfap43 C A 19: 47,815,846 V304L probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Cpa5 T C 6: 30,623,211 S124P probably damaging Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dmxl1 T C 18: 49,833,148 V20A probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fezf1 T C 6: 23,246,999 H278R probably benign Het
Fhod3 T A 18: 25,066,218 Y649N probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm597 A G 1: 28,777,821 S377P possibly damaging Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itga2 A G 13: 114,856,679 V800A probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itgb5 A G 16: 33,900,583 K339R probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Kcnd2 T C 6: 21,726,239 probably benign Het
Kcnd2 T A 6: 21,727,329 V627E probably damaging Het
Ktn1 A G 14: 47,701,062 probably null Het
Lamp1 T A 8: 13,172,654 F279L probably damaging Het
Macf1 A G 4: 123,494,882 probably null Het
Mark2 A G 19: 7,285,824 Y193H probably damaging Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Myom2 A T 8: 15,132,924 K1454* probably null Het
Nfkbia C A 12: 55,490,776 A211S probably damaging Het
Olfr504 T C 7: 108,564,998 T266A possibly damaging Het
Olfr629 T C 7: 103,740,925 H105R probably damaging Het
Olfr905 A T 9: 38,472,785 I13F probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Pmch A G 10: 88,091,224 I30V probably benign Het
Ppat A C 5: 76,922,501 Y157D probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rbp3 T G 14: 33,956,638 S848A possibly damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Rictor A G 15: 6,764,278 probably null Het
Rims1 T C 1: 22,427,459 probably null Het
Slc22a28 T C 19: 8,116,833 Y245C possibly damaging Het
Slc25a1 T A 16: 17,927,436 H78L probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc34a2 A G 5: 53,067,707 T397A probably benign Het
Slc51a T A 16: 32,475,849 T306S probably benign Het
Sorcs3 G A 19: 48,487,394 V231I probably benign Het
Sp100 A T 1: 85,699,744 I86L probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tax1bp1 C T 6: 52,741,940 probably benign Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tex24 A T 8: 27,344,720 H92L possibly damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Thbs4 T G 13: 92,758,038 D659A probably damaging Het
Tmed11 A T 5: 108,795,309 M1K probably null Het
Tmpo A T 10: 91,161,953 C657* probably null Het
Unc5a C A 13: 55,003,933 N56K possibly damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Vmn2r17 A T 5: 109,427,956 H231L possibly damaging Het
Wrn A G 8: 33,295,006 I446T possibly damaging Het
Zfp266 G A 9: 20,499,799 H361Y probably damaging Het
Other mutations in Shc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Shc1 APN 3 89424229 missense probably damaging 0.99
IGL01608:Shc1 APN 3 89424849 missense probably damaging 0.96
IGL02710:Shc1 APN 3 89424610 splice site probably null
PIT4382001:Shc1 UTSW 3 89427408 missense probably benign 0.00
R0323:Shc1 UTSW 3 89423713 missense probably damaging 0.98
R0445:Shc1 UTSW 3 89426537 missense probably damaging 1.00
R0827:Shc1 UTSW 3 89426783 splice site probably null
R0833:Shc1 UTSW 3 89422969 missense probably damaging 1.00
R1155:Shc1 UTSW 3 89424819 missense probably benign 0.30
R1497:Shc1 UTSW 3 89428445 makesense probably null
R1929:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R2271:Shc1 UTSW 3 89423542 missense probably damaging 1.00
R4402:Shc1 UTSW 3 89426678 missense probably benign
R4965:Shc1 UTSW 3 89426996 missense probably damaging 0.98
R5898:Shc1 UTSW 3 89426967 nonsense probably null
R6198:Shc1 UTSW 3 89422107 missense probably benign
R6604:Shc1 UTSW 3 89421879 missense probably damaging 1.00
R6673:Shc1 UTSW 3 89421962 missense possibly damaging 0.93
R6705:Shc1 UTSW 3 89422959 nonsense probably null
R7379:Shc1 UTSW 3 89426822 missense probably benign 0.00
R8041:Shc1 UTSW 3 89422953 missense probably damaging 1.00
R8284:Shc1 UTSW 3 89421908 missense possibly damaging 0.70
R8700:Shc1 UTSW 3 89427433 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCCAAGCACATCTGAGGCTTTCTG -3'
(R):5'- ATCTTCCCGCAATCTCCAAGGCTG -3'

Sequencing Primer
(F):5'- TTGCCATACACCTATGAAGTGGAAG -3'
(R):5'- GCAATCTCCAAGGCTGGATAG -3'
Posted On2013-10-16