Mutagenetix > Incidental Mutation

Incidental Mutation 'R0836:Kcnd2'

77899

Institutional Source

Beutler Lab

Gene Symbol

Kcnd2

Ensembl Gene

ENSMUSG00000060882

Gene Name

potassium voltage-gated channel, Shal-related family, member 2

Synonyms

Kv4.2

MMRRC Submission

039015-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R0836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21215503-21729805 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 21726239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000080257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081542]

AlphaFold

Q9Z0V2

Predicted Effect

probably benign
Transcript: ENSMUST00000081542

SMART Domains

Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882

Domain	Start	End	E-Value	Type
Pfam:Shal-type	3	31	4.5e-16	PFAM
BTB	41	140	3.42e-14	SMART
Pfam:Ion_trans	184	417	1.4e-44	PFAM
Pfam:Ion_trans_2	330	411	5.5e-15	PFAM
low complexity region	418	437	N/A	INTRINSIC
Pfam:DUF3399	445	546	5.5e-44	PFAM
low complexity region	594	608	N/A	INTRINSIC

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.9%
20x: 92.2%

Validation Efficiency

100% (102/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	A	G	5: 139,364,120	V58A	possibly damaging	Het
4932415M13Rik	A	T	17: 53,724,346		noncoding transcript	Het
A930003A15Rik	T	C	16: 19,883,872		noncoding transcript	Het
Abca8a	A	T	11: 110,040,564	D1253E	possibly damaging	Het
Acsm3	T	C	7: 119,777,100	I350T	possibly damaging	Het
Adcy9	T	C	16: 4,419,271	D92G	possibly damaging	Het
Aldh9a1	G	A	1: 167,350,255	G7D	probably benign	Het
Alg14	A	G	3: 121,298,610	H34R	probably damaging	Het
Ankrd27	A	G	7: 35,608,347	N337S	probably damaging	Het
Apoa2	T	A	1: 171,225,379		probably benign	Het
Asphd2	A	T	5: 112,391,769	L66H	probably damaging	Het
Astl	T	C	2: 127,342,419	F21L	probably benign	Het
Bptf	C	A	11: 107,110,812		probably null	Het
Cacna2d4	C	T	6: 119,307,286	R745W	probably damaging	Het
Cadps2	T	C	6: 23,328,776		probably benign	Het
Camk4	G	T	18: 32,939,454	S20I	unknown	Het
Ccdc36	A	T	9: 108,404,801	C563S	probably benign	Het
Ccdc85a	T	A	11: 28,583,296	I83F	probably damaging	Het
Ccnt2	T	A	1: 127,802,394	M336K	probably benign	Het
Cd209e	G	T	8: 3,853,205	D62E	probably benign	Het
Ces1f	A	T	8: 93,270,024	S214T	probably damaging	Het
Cfap43	C	A	19: 47,815,846	V304L	probably benign	Het
Col26a1	A	G	5: 136,765,300		probably null	Het
Cpa5	T	C	6: 30,623,211	S124P	probably damaging	Het
Crtc1	A	G	8: 70,393,013	V306A	probably benign	Het
D130043K22Rik	G	A	13: 24,863,580		probably benign	Het
D17H6S53E	A	T	17: 35,127,409		probably null	Het
D17Wsu92e	A	T	17: 27,786,138	S148R	probably damaging	Het
Dmxl1	T	C	18: 49,833,148	V20A	probably damaging	Het
Dnah11	G	A	12: 118,196,662	A111V	probably benign	Het
Dyrk2	T	C	10: 118,861,122	H77R	probably benign	Het
E330017A01Rik	G	A	16: 58,635,523	S129L	probably damaging	Het
Epha3	A	G	16: 63,603,519		probably benign	Het
Epn2	T	C	11: 61,519,491	N611S	probably benign	Het
Erich6	A	C	3: 58,618,944		probably benign	Het
Fam217b	T	C	2: 178,420,989	S249P	probably benign	Het
Fezf1	T	C	6: 23,246,999	H278R	probably benign	Het
Fhod3	T	A	18: 25,066,218	Y649N	probably damaging	Het
Gm5155	C	A	7: 17,904,981	A301E	possibly damaging	Het
Gm597	A	G	1: 28,777,821	S377P	possibly damaging	Het
Grap	T	A	11: 61,660,239	D32E	possibly damaging	Het
Hipk1	A	G	3: 103,754,296	S670P	probably damaging	Het
Itga2	A	G	13: 114,856,679	V800A	probably damaging	Het
Itgae	A	T	11: 73,129,206	M845L	probably benign	Het
Itgb5	A	G	16: 33,900,583	K339R	probably damaging	Het
Itpka	T	A	2: 119,750,831	N448K	probably damaging	Het
Jak3	A	C	8: 71,683,978	N643T	probably damaging	Het
Ktn1	A	G	14: 47,701,062		probably null	Het
Lamp1	T	A	8: 13,172,654	F279L	probably damaging	Het
Macf1	A	G	4: 123,494,882		probably null	Het
Mark2	A	G	19: 7,285,824	Y193H	probably damaging	Het
Mcrs1	T	C	15: 99,243,449		probably benign	Het
Mtnr1a	A	T	8: 45,087,937	I312F	probably benign	Het
Myom2	A	T	8: 15,132,924	K1454*	probably null	Het
Nfkbia	C	A	12: 55,490,776	A211S	probably damaging	Het
Olfr504	T	C	7: 108,564,998	T266A	possibly damaging	Het
Olfr629	T	C	7: 103,740,925	H105R	probably damaging	Het
Olfr905	A	T	9: 38,472,785	I13F	probably benign	Het
Otog	C	T	7: 46,269,362	T954I	possibly damaging	Het
Phlpp2	A	G	8: 109,937,106	T926A	probably damaging	Het
Plec	GGCAGCAG	GGCAGCAGCAG	15: 76,181,907		probably benign	Het
Plekha5	T	A	6: 140,589,634		probably benign	Het
Pmch	A	G	10: 88,091,224	I30V	probably benign	Het
Ppat	A	C	5: 76,922,501	Y157D	probably benign	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Rab27b	T	C	18: 69,987,041		probably benign	Het
Rapsn	T	C	2: 91,036,808	Y152H	probably damaging	Het
Rasd1	A	T	11: 59,964,553	F85I	probably damaging	Het
Rbp3	T	G	14: 33,956,638	S848A	possibly damaging	Het
Rgs1	A	T	1: 144,247,933	S85T	probably damaging	Het
Rictor	A	G	15: 6,764,278		probably null	Het
Rims1	T	C	1: 22,427,459		probably null	Het
Shc1	A	G	3: 89,422,969	D70G	probably damaging	Het
Slc22a28	T	C	19: 8,116,833	Y245C	possibly damaging	Het
Slc25a1	T	A	16: 17,927,436	H78L	probably benign	Het
Slc30a7	T	A	3: 115,990,140		probably null	Het
Slc34a2	A	G	5: 53,067,707	T397A	probably benign	Het
Slc51a	T	A	16: 32,475,849	T306S	probably benign	Het
Sorcs3	G	A	19: 48,487,394	V231I	probably benign	Het
Sp100	A	T	1: 85,699,744	I86L	probably damaging	Het
Stard9	T	G	2: 120,696,999	S1246A	possibly damaging	Het
Stxbp5	A	T	10: 9,865,099	S116R	probably damaging	Het
Tas2r105	T	C	6: 131,687,430	I12V	probably benign	Het
Tas2r121	A	G	6: 132,700,362	S216P	probably damaging	Het
Tax1bp1	C	T	6: 52,741,940		probably benign	Het
Tcof1	T	C	18: 60,845,832	D48G	probably damaging	Het
Tex24	A	T	8: 27,344,720	H92L	possibly damaging	Het
Tgm3	C	T	2: 130,026,682		probably benign	Het
Thbs4	T	G	13: 92,758,038	D659A	probably damaging	Het
Tmed11	A	T	5: 108,795,309	M1K	probably null	Het
Tmpo	A	T	10: 91,161,953	C657*	probably null	Het
Unc5a	C	A	13: 55,003,933	N56K	possibly damaging	Het
Urb1	T	C	16: 90,795,448	D308G	possibly damaging	Het
Vav3	A	G	3: 109,647,679	N81S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,459	D267E	probably benign	Het
Vmn2r17	A	T	5: 109,427,956	H231L	possibly damaging	Het
Wrn	A	G	8: 33,295,006	I446T	possibly damaging	Het
Zfp266	G	A	9: 20,499,799	H361Y	probably damaging	Het

Other mutations in Kcnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Kcnd2	APN	6	21714154	missense	possibly damaging	0.90
IGL01124:Kcnd2	APN	6	21217217	missense	probably damaging	1.00
IGL01317:Kcnd2	APN	6	21727340	makesense	probably null
IGL01534:Kcnd2	APN	6	21726145	missense	probably benign
IGL02623:Kcnd2	APN	6	21726195	missense	probably benign	0.05
IGL02682:Kcnd2	APN	6	21216925	nonsense	probably null
IGL02874:Kcnd2	APN	6	21216923	missense	probably damaging	1.00
IGL02982:Kcnd2	APN	6	21217149	missense	probably damaging	1.00
IGL02983:Kcnd2	APN	6	21216555	missense	probably damaging	1.00
IGL03119:Kcnd2	APN	6	21216509	nonsense	probably null
IGL03154:Kcnd2	APN	6	21216708	missense	probably damaging	1.00
IGL03174:Kcnd2	APN	6	21216516	missense	possibly damaging	0.93
IGL03296:Kcnd2	APN	6	21714209	missense	probably damaging	1.00
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0062:Kcnd2	UTSW	6	21727226	missense	possibly damaging	0.80
R0325:Kcnd2	UTSW	6	21216683	missense	probably damaging	0.99
R0771:Kcnd2	UTSW	6	21216442	missense	probably damaging	1.00
R0836:Kcnd2	UTSW	6	21727329	missense	probably damaging	1.00
R0884:Kcnd2	UTSW	6	21216541	missense	probably benign
R1434:Kcnd2	UTSW	6	21216357	missense	probably damaging	1.00
R2116:Kcnd2	UTSW	6	21216432	missense	probably damaging	1.00
R3863:Kcnd2	UTSW	6	21217263	nonsense	probably null
R3939:Kcnd2	UTSW	6	21217096	missense	probably damaging	1.00
R4427:Kcnd2	UTSW	6	21216897	missense	probably damaging	0.99
R4561:Kcnd2	UTSW	6	21216396	missense	probably benign
R4707:Kcnd2	UTSW	6	21723212	missense	probably benign
R5523:Kcnd2	UTSW	6	21723212	missense	probably benign
R5545:Kcnd2	UTSW	6	21217019	missense	probably damaging	1.00
R5926:Kcnd2	UTSW	6	21217085	missense	probably damaging	0.99
R6900:Kcnd2	UTSW	6	21216588	missense	probably damaging	1.00
R7010:Kcnd2	UTSW	6	21216708	missense	probably damaging	1.00
R7028:Kcnd2	UTSW	6	21216178	start gained	probably benign
R7183:Kcnd2	UTSW	6	21216437	missense	probably damaging	1.00
R7387:Kcnd2	UTSW	6	21216778	missense	probably benign	0.28
R7463:Kcnd2	UTSW	6	21216498	missense	probably damaging	1.00
R8007:Kcnd2	UTSW	6	21217074	missense	probably damaging	0.99
R8305:Kcnd2	UTSW	6	21726198	nonsense	probably null
R8465:Kcnd2	UTSW	6	21216696	missense	probably damaging	1.00
R9329:Kcnd2	UTSW	6	21725982	missense	probably damaging	1.00
R9532:Kcnd2	UTSW	6	21727181	missense	probably benign	0.16
R9766:Kcnd2	UTSW	6	21216368	missense	probably benign	0.20
X0021:Kcnd2	UTSW	6	21217323	missense	probably damaging	0.99
Z1177:Kcnd2	UTSW	6	21216416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAGGAGTCACCAGCACTTGC -3'
(R):5'- AGGCTTCAGCATGTAATGTCATCCC -3'

Sequencing Primer
(F):5'- ACTTGCTGCTCACGGAGAC -3'
(R):5'- tccctgtctctgcctcc -3'

Posted On

2013-10-16