Incidental Mutation 'R0836:Or56b1b'
ID 77913
Institutional Source Beutler Lab
Gene Symbol Or56b1b
Ensembl Gene ENSMUSG00000060105
Gene Name olfactory receptor family 56 subfamily B member 1B
Synonyms MOR40-15, MOR40-7P, Olfr504, GA_x6K02T2PBJ9-10895499-10894543
MMRRC Submission 039015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R0836 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 108164044-108165000 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108164205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 266 (T266A)
Ref Sequence ENSEMBL: ENSMUSP00000075025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075595]
AlphaFold Q7TRU7
Predicted Effect possibly damaging
Transcript: ENSMUST00000075595
AA Change: T266A

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075025
Gene: ENSMUSG00000060105
AA Change: T266A

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.9e-70 PFAM
Pfam:7TM_GPCR_Srsx 40 311 5.1e-10 PFAM
Pfam:7tm_1 47 296 3.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207240
Meta Mutation Damage Score 0.3321 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.9%
  • 20x: 92.2%
Validation Efficiency 100% (102/102)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik A G 5: 139,349,875 (GRCm39) V58A possibly damaging Het
4932415M13Rik A T 17: 54,031,374 (GRCm39) noncoding transcript Het
A930003A15Rik T C 16: 19,702,622 (GRCm39) noncoding transcript Het
Abca8a A T 11: 109,931,390 (GRCm39) D1253E possibly damaging Het
Acsm3 T C 7: 119,376,323 (GRCm39) I350T possibly damaging Het
Adcy9 T C 16: 4,237,135 (GRCm39) D92G possibly damaging Het
Aldh9a1 G A 1: 167,177,824 (GRCm39) G7D probably benign Het
Alg14 A G 3: 121,092,259 (GRCm39) H34R probably damaging Het
Ankrd27 A G 7: 35,307,772 (GRCm39) N337S probably damaging Het
Apoa2 T A 1: 171,052,948 (GRCm39) probably benign Het
Asphd2 A T 5: 112,539,635 (GRCm39) L66H probably damaging Het
Astl T C 2: 127,184,339 (GRCm39) F21L probably benign Het
Bptf C A 11: 107,001,638 (GRCm39) probably null Het
Cacna2d4 C T 6: 119,284,247 (GRCm39) R745W probably damaging Het
Cadps2 T C 6: 23,328,775 (GRCm39) probably benign Het
Camk4 G T 18: 33,072,507 (GRCm39) S20I unknown Het
Ccdc85a T A 11: 28,533,296 (GRCm39) I83F probably damaging Het
Ccnt2 T A 1: 127,730,131 (GRCm39) M336K probably benign Het
Cd209e G T 8: 3,903,205 (GRCm39) D62E probably benign Het
Ceacam23 C A 7: 17,638,906 (GRCm39) A301E possibly damaging Het
Ces1f A T 8: 93,996,652 (GRCm39) S214T probably damaging Het
Cfap43 C A 19: 47,804,285 (GRCm39) V304L probably benign Het
Col26a1 A G 5: 136,794,154 (GRCm39) probably null Het
Cpa5 T C 6: 30,623,210 (GRCm39) S124P probably damaging Het
Crtc1 A G 8: 70,845,663 (GRCm39) V306A probably benign Het
D130043K22Rik G A 13: 25,047,563 (GRCm39) probably benign Het
D17H6S53E A T 17: 35,346,385 (GRCm39) probably null Het
Dmxl1 T C 18: 49,966,215 (GRCm39) V20A probably damaging Het
Dnah11 G A 12: 118,160,397 (GRCm39) A111V probably benign Het
Dyrk2 T C 10: 118,697,027 (GRCm39) H77R probably benign Het
Epha3 A G 16: 63,423,882 (GRCm39) probably benign Het
Epn2 T C 11: 61,410,317 (GRCm39) N611S probably benign Het
Erich6 A C 3: 58,526,365 (GRCm39) probably benign Het
Fam217b T C 2: 178,062,782 (GRCm39) S249P probably benign Het
Fezf1 T C 6: 23,246,998 (GRCm39) H278R probably benign Het
Fhod3 T A 18: 25,199,275 (GRCm39) Y649N probably damaging Het
Ftdc2 G A 16: 58,455,886 (GRCm39) S129L probably damaging Het
Grap T A 11: 61,551,065 (GRCm39) D32E possibly damaging Het
Hipk1 A G 3: 103,661,612 (GRCm39) S670P probably damaging Het
Iho1 A T 9: 108,282,000 (GRCm39) C563S probably benign Het
Ilrun A T 17: 28,005,112 (GRCm39) S148R probably damaging Het
Itga2 A G 13: 114,993,215 (GRCm39) V800A probably damaging Het
Itgae A T 11: 73,020,032 (GRCm39) M845L probably benign Het
Itgb5 A G 16: 33,720,953 (GRCm39) K339R probably damaging Het
Itpka T A 2: 119,581,312 (GRCm39) N448K probably damaging Het
Jak3 A C 8: 72,136,622 (GRCm39) N643T probably damaging Het
Kcnd2 T A 6: 21,727,328 (GRCm39) V627E probably damaging Het
Kcnd2 T C 6: 21,726,238 (GRCm39) probably benign Het
Ktn1 A G 14: 47,938,519 (GRCm39) probably null Het
Lamp1 T A 8: 13,222,654 (GRCm39) F279L probably damaging Het
Macf1 A G 4: 123,388,675 (GRCm39) probably null Het
Mark2 A G 19: 7,263,189 (GRCm39) Y193H probably damaging Het
Mcrs1 T C 15: 99,141,330 (GRCm39) probably benign Het
Mtnr1a A T 8: 45,540,974 (GRCm39) I312F probably benign Het
Myom2 A T 8: 15,182,924 (GRCm39) K1454* probably null Het
Nfkbia C A 12: 55,537,561 (GRCm39) A211S probably damaging Het
Or52ae9 T C 7: 103,390,132 (GRCm39) H105R probably damaging Het
Or8b1c A T 9: 38,384,081 (GRCm39) I13F probably benign Het
Otog C T 7: 45,918,786 (GRCm39) T954I possibly damaging Het
Phlpp2 A G 8: 110,663,738 (GRCm39) T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,066,107 (GRCm39) probably benign Het
Plekha5 T A 6: 140,535,360 (GRCm39) probably benign Het
Pmch A G 10: 87,927,086 (GRCm39) I30V probably benign Het
Ppat A C 5: 77,070,348 (GRCm39) Y157D probably benign Het
Ppp1r16a C T 15: 76,577,869 (GRCm39) Q328* probably null Het
Rab27b T C 18: 70,120,112 (GRCm39) probably benign Het
Rapsn T C 2: 90,867,153 (GRCm39) Y152H probably damaging Het
Rasd1 A T 11: 59,855,379 (GRCm39) F85I probably damaging Het
Rbp3 T G 14: 33,678,595 (GRCm39) S848A possibly damaging Het
Rgs1 A T 1: 144,123,671 (GRCm39) S85T probably damaging Het
Rictor A G 15: 6,793,759 (GRCm39) probably null Het
Rims1 T C 1: 22,497,709 (GRCm39) probably null Het
Shc1 A G 3: 89,330,276 (GRCm39) D70G probably damaging Het
Slc22a28 T C 19: 8,094,197 (GRCm39) Y245C possibly damaging Het
Slc25a1 T A 16: 17,745,300 (GRCm39) H78L probably benign Het
Slc30a7 T A 3: 115,783,789 (GRCm39) probably null Het
Slc34a2 A G 5: 53,225,049 (GRCm39) T397A probably benign Het
Slc51a T A 16: 32,294,667 (GRCm39) T306S probably benign Het
Sorcs3 G A 19: 48,475,833 (GRCm39) V231I probably benign Het
Sp100 A T 1: 85,627,465 (GRCm39) I86L probably damaging Het
Spata31e5 A G 1: 28,816,902 (GRCm39) S377P possibly damaging Het
Stard9 T G 2: 120,527,480 (GRCm39) S1246A possibly damaging Het
Stxbp5 A T 10: 9,740,843 (GRCm39) S116R probably damaging Het
Tas2r105 T C 6: 131,664,393 (GRCm39) I12V probably benign Het
Tas2r121 A G 6: 132,677,325 (GRCm39) S216P probably damaging Het
Tax1bp1 C T 6: 52,718,925 (GRCm39) probably benign Het
Tcof1 T C 18: 60,978,904 (GRCm39) D48G probably damaging Het
Tex24 A T 8: 27,834,748 (GRCm39) H92L possibly damaging Het
Tgm3 C T 2: 129,868,602 (GRCm39) probably benign Het
Thbs4 T G 13: 92,894,546 (GRCm39) D659A probably damaging Het
Tmed11 A T 5: 108,943,175 (GRCm39) M1K probably null Het
Tmpo A T 10: 90,997,815 (GRCm39) C657* probably null Het
Unc5a C A 13: 55,151,746 (GRCm39) N56K possibly damaging Het
Urb1 T C 16: 90,592,336 (GRCm39) D308G possibly damaging Het
Vav3 A G 3: 109,554,995 (GRCm39) N81S possibly damaging Het
Vmn2r108 A T 17: 20,691,721 (GRCm39) D267E probably benign Het
Vmn2r17 A T 5: 109,575,822 (GRCm39) H231L possibly damaging Het
Wrn A G 8: 33,785,034 (GRCm39) I446T possibly damaging Het
Zfp266 G A 9: 20,411,095 (GRCm39) H361Y probably damaging Het
Other mutations in Or56b1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Or56b1b APN 7 108,164,409 (GRCm39) missense probably benign 0.02
IGL01447:Or56b1b APN 7 108,164,216 (GRCm39) missense possibly damaging 0.75
IGL01845:Or56b1b APN 7 108,164,343 (GRCm39) missense possibly damaging 0.76
IGL02110:Or56b1b APN 7 108,164,286 (GRCm39) missense probably damaging 1.00
IGL03196:Or56b1b APN 7 108,164,061 (GRCm39) missense probably benign
R0282:Or56b1b UTSW 7 108,164,684 (GRCm39) missense probably damaging 1.00
R0359:Or56b1b UTSW 7 108,164,721 (GRCm39) missense probably benign 0.01
R0514:Or56b1b UTSW 7 108,164,879 (GRCm39) missense probably damaging 1.00
R0727:Or56b1b UTSW 7 108,164,315 (GRCm39) missense probably benign 0.00
R0744:Or56b1b UTSW 7 108,164,205 (GRCm39) missense possibly damaging 0.57
R0840:Or56b1b UTSW 7 108,164,823 (GRCm39) missense probably benign 0.00
R0883:Or56b1b UTSW 7 108,164,483 (GRCm39) missense probably benign 0.01
R1750:Or56b1b UTSW 7 108,164,564 (GRCm39) nonsense probably null
R1827:Or56b1b UTSW 7 108,164,282 (GRCm39) missense probably benign 0.35
R1933:Or56b1b UTSW 7 108,164,730 (GRCm39) missense possibly damaging 0.57
R3004:Or56b1b UTSW 7 108,164,151 (GRCm39) missense probably benign 0.42
R3766:Or56b1b UTSW 7 108,164,402 (GRCm39) missense probably benign 0.00
R5179:Or56b1b UTSW 7 108,164,433 (GRCm39) missense probably benign
R5408:Or56b1b UTSW 7 108,164,376 (GRCm39) missense probably damaging 0.99
R5493:Or56b1b UTSW 7 108,164,774 (GRCm39) missense probably benign 0.24
R5569:Or56b1b UTSW 7 108,164,772 (GRCm39) missense probably benign 0.01
R6520:Or56b1b UTSW 7 108,164,046 (GRCm39) makesense probably null
R6798:Or56b1b UTSW 7 108,164,967 (GRCm39) nonsense probably null
R6803:Or56b1b UTSW 7 108,164,620 (GRCm39) missense probably damaging 1.00
R7242:Or56b1b UTSW 7 108,164,919 (GRCm39) missense probably benign 0.03
R7559:Or56b1b UTSW 7 108,164,763 (GRCm39) missense probably damaging 0.99
R7644:Or56b1b UTSW 7 108,164,649 (GRCm39) missense possibly damaging 0.78
R8498:Or56b1b UTSW 7 108,164,833 (GRCm39) nonsense probably null
R8970:Or56b1b UTSW 7 108,164,997 (GRCm39) missense probably benign 0.00
R9014:Or56b1b UTSW 7 108,164,882 (GRCm39) missense possibly damaging 0.63
R9093:Or56b1b UTSW 7 108,164,454 (GRCm39) missense probably damaging 1.00
R9103:Or56b1b UTSW 7 108,164,780 (GRCm39) missense probably benign 0.02
R9548:Or56b1b UTSW 7 108,164,334 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GAAGGCACTTCAATTCCCCTCCATC -3'
(R):5'- TTGCCTGTGCTCTAACCTTGGAATC -3'

Sequencing Primer
(F):5'- GCTACCATACATTTAGGAGATGCTG -3'
(R):5'- CAAGCCTGGCATGTGATGAC -3'
Posted On 2013-10-16